Incidental Mutation 'R7558:March8'
ID584884
Institutional Source Beutler Lab
Gene Symbol March8
Ensembl Gene ENSMUSG00000025702
Gene Namemembrane-associated ring finger (C3HC4) 8
Synonyms1300017E09Rik, Mir
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7558 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116338024-116409540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116403565 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 126 (F126L)
Ref Sequence ENSEMBL: ENSMUSP00000078024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079012] [ENSMUST00000101032] [ENSMUST00000123405] [ENSMUST00000135901] [ENSMUST00000140884] [ENSMUST00000203116] [ENSMUST00000203193] [ENSMUST00000204657]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079012
AA Change: F126L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078024
Gene: ENSMUSG00000025702
AA Change: F126L

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101032
AA Change: F126L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098594
Gene: ENSMUSG00000025702
AA Change: F126L

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123405
AA Change: F408L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144936
Gene: ENSMUSG00000025702
AA Change: F408L

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
RINGv 357 405 2.4e-25 SMART
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135901
AA Change: F105L

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115510
Gene: ENSMUSG00000025702
AA Change: F105L

DomainStartEndE-ValueType
low complexity region 43 60 N/A INTRINSIC
RINGv 71 119 1.16e-23 SMART
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140884
SMART Domains Protein: ENSMUSP00000145060
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203116
Predicted Effect possibly damaging
Transcript: ENSMUST00000203193
AA Change: F87L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145137
Gene: ENSMUSG00000025702
AA Change: F87L

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
RINGv 36 84 2.9e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204657
AA Change: F126L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145351
Gene: ENSMUSG00000025702
AA Change: F126L

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 2.9e-26 SMART
transmembrane domain 151 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the membrane-associated really interesting new gene-CH family of proteins. These proteins are E3 ubiquitin-protein ligases that modulate antigen presentation by downregulating major histocompatibility complex class II surface expression through endocytosis. The transcript is primarily expressed by dendritic cells and macrophages. Overexpression of this gene in antigen presenting cells results in immune defective phenotypes, including resistance to autoimmune disease onset. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal CD4+ T cell compartment in the thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in March8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:March8 APN 6 116403538 missense probably damaging 1.00
strider UTSW 6 116402043 missense probably benign
R0828:March8 UTSW 6 116405678 missense probably benign 0.36
R2869:March8 UTSW 6 116401145 intron probably benign
R2870:March8 UTSW 6 116401145 intron probably benign
R4963:March8 UTSW 6 116386271 intron probably benign
R5617:March8 UTSW 6 116403520 missense possibly damaging 0.55
R6329:March8 UTSW 6 116406316 missense possibly damaging 0.78
R6361:March8 UTSW 6 116402101 missense probably null 1.00
R6615:March8 UTSW 6 116405663 missense probably damaging 1.00
R6771:March8 UTSW 6 116402043 missense probably benign
R7014:March8 UTSW 6 116403543 missense probably damaging 1.00
R7014:March8 UTSW 6 116403544 missense probably damaging 1.00
R7249:March8 UTSW 6 116406234 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGCTGACAGTCACTTTTACGG -3'
(R):5'- AGACCTGAGCCATTACCATCAG -3'

Sequencing Primer
(F):5'- AATTGGCCTTCTGGTGCAGC -3'
(R):5'- TTACCATCAGAAGTAAGGCTCG -3'
Posted On2019-10-17