Incidental Mutation 'R7558:Olfr503'
ID584887
Institutional Source Beutler Lab
Gene Symbol Olfr503
Ensembl Gene ENSMUSG00000060759
Gene Nameolfactory receptor 503
SynonymsGA_x6K02T2PBJ9-10874315-10875286, Olfr1548, MOR34-8P, MOR34-9, MOR34-9, MOR34-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108544527-108545498 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to G at 108544721 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 65 (Y65*)
Ref Sequence ENSEMBL: ENSMUSP00000077296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078162] [ENSMUST00000211693]
Predicted Effect probably null
Transcript: ENSMUST00000078162
AA Change: Y65*
SMART Domains Protein: ENSMUSP00000077296
Gene: ENSMUSG00000060759
AA Change: Y65*

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 3e-103 PFAM
Pfam:7TM_GPCR_Srsx 39 268 2.4e-7 PFAM
Pfam:7tm_1 45 297 9.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211693
AA Change: Y63*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Olfr503
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Olfr503 APN 7 108544726 nonsense probably null
IGL02031:Olfr503 APN 7 108544930 missense probably benign 0.03
IGL02426:Olfr503 APN 7 108544980 missense probably benign 0.01
IGL02502:Olfr503 APN 7 108544639 missense probably damaging 1.00
IGL03208:Olfr503 APN 7 108545119 missense probably benign 0.02
R0507:Olfr503 UTSW 7 108545085 missense probably damaging 0.98
R0967:Olfr503 UTSW 7 108544789 missense probably damaging 1.00
R1181:Olfr503 UTSW 7 108545302 missense probably benign 0.00
R1501:Olfr503 UTSW 7 108544575 missense probably benign
R1596:Olfr503 UTSW 7 108545083 missense possibly damaging 0.90
R1657:Olfr503 UTSW 7 108545377 missense possibly damaging 0.50
R1708:Olfr503 UTSW 7 108544574 missense probably benign 0.04
R2215:Olfr503 UTSW 7 108544888 missense probably damaging 1.00
R4131:Olfr503 UTSW 7 108544537 nonsense probably null
R4772:Olfr503 UTSW 7 108544885 missense probably damaging 0.98
R5009:Olfr503 UTSW 7 108544848 missense probably benign 0.01
R5297:Olfr503 UTSW 7 108545404 missense probably damaging 1.00
R5788:Olfr503 UTSW 7 108545344 missense probably damaging 0.97
R5944:Olfr503 UTSW 7 108545277 missense possibly damaging 0.90
R6522:Olfr503 UTSW 7 108544995 missense probably benign 0.09
R7045:Olfr503 UTSW 7 108545245 missense probably damaging 1.00
R7339:Olfr503 UTSW 7 108544900 missense probably damaging 1.00
R7585:Olfr503 UTSW 7 108545391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGTGGGATTAGCATG -3'
(R):5'- ACATAGTGGTCCAGAGCCATG -3'

Sequencing Primer
(F):5'- AGCATGGTCATGTCAGCG -3'
(R):5'- GCCATGAGCATGAGCACTC -3'
Posted On2019-10-17