Incidental Mutation 'R7558:Smarcc1'
ID584889
Institutional Source Beutler Lab
Gene Symbol Smarcc1
Ensembl Gene ENSMUSG00000032481
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
SynonymsBAF155, SRG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110117708-110240178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110147116 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 157 (T157K)
Ref Sequence ENSEMBL: ENSMUSP00000086094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088716] [ENSMUST00000098355] [ENSMUST00000197480] [ENSMUST00000197984] [ENSMUST00000199896]
Predicted Effect probably damaging
Transcript: ENSMUST00000088716
AA Change: T157K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086094
Gene: ENSMUSG00000032481
AA Change: T157K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.7e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 9.6e-35 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 2.5e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
low complexity region 1075 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098355
SMART Domains Protein: ENSMUSP00000095958
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 62 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197480
AA Change: T157K

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142629
Gene: ENSMUSG00000032481
AA Change: T157K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197984
AA Change: T157K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142611
Gene: ENSMUSG00000032481
AA Change: T157K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 448 536 1.4e-35 PFAM
SANT 618 666 4.52e-12 SMART
low complexity region 710 717 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 768 781 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 866 885 N/A INTRINSIC
coiled coil region 909 945 N/A INTRINSIC
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199896
AA Change: T157K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143550
Gene: ENSMUSG00000032481
AA Change: T157K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.5e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 1.4e-34 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 1.4e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out mutation display early embryonic lethality soon after decidualization due to failed egg cylinder formation and defects in the inner cell mass and primitive endoderm. About 20% of heterozygous mutant embryos show exencephaly caused by failure in neural fold elevation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Smarcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Smarcc1 APN 9 110221937 missense probably damaging 1.00
IGL01152:Smarcc1 APN 9 110139625 missense possibly damaging 0.89
IGL01353:Smarcc1 APN 9 110135666 missense probably benign 0.07
IGL01401:Smarcc1 APN 9 110149965 missense possibly damaging 0.52
IGL01483:Smarcc1 APN 9 110222060 nonsense probably null
IGL01679:Smarcc1 APN 9 110213530 missense probably damaging 1.00
IGL02458:Smarcc1 APN 9 110132126 intron probably benign
IGL02498:Smarcc1 APN 9 110190934 missense probably damaging 1.00
IGL02605:Smarcc1 APN 9 110222000 missense possibly damaging 0.86
IGL03003:Smarcc1 APN 9 110206100 missense probably damaging 0.97
IGL03284:Smarcc1 APN 9 110175074 missense probably benign 0.30
R0116:Smarcc1 UTSW 9 110147104 missense possibly damaging 0.71
R0403:Smarcc1 UTSW 9 110237808 splice site probably null
R1436:Smarcc1 UTSW 9 110118640 unclassified probably benign
R1583:Smarcc1 UTSW 9 110213617 missense probably damaging 1.00
R1692:Smarcc1 UTSW 9 110174004 missense possibly damaging 0.85
R1732:Smarcc1 UTSW 9 110185820 splice site probably benign
R1833:Smarcc1 UTSW 9 110153811 missense possibly damaging 0.71
R1881:Smarcc1 UTSW 9 110175099 missense probably damaging 1.00
R2058:Smarcc1 UTSW 9 110118343 unclassified probably benign
R2175:Smarcc1 UTSW 9 110164809 missense possibly damaging 0.71
R2215:Smarcc1 UTSW 9 110237839 utr 3 prime probably benign
R2904:Smarcc1 UTSW 9 110173975 missense possibly damaging 0.80
R3899:Smarcc1 UTSW 9 110118518 unclassified probably benign
R3900:Smarcc1 UTSW 9 110118518 unclassified probably benign
R4012:Smarcc1 UTSW 9 110132205 missense possibly damaging 0.96
R4091:Smarcc1 UTSW 9 110164829 missense possibly damaging 0.84
R4356:Smarcc1 UTSW 9 110196256 missense probably damaging 0.99
R4881:Smarcc1 UTSW 9 110135628 start gained probably benign
R4993:Smarcc1 UTSW 9 110175061 missense probably damaging 1.00
R5110:Smarcc1 UTSW 9 110197784 missense possibly damaging 0.89
R5375:Smarcc1 UTSW 9 110190949 missense probably damaging 0.99
R5655:Smarcc1 UTSW 9 110157344 missense probably null 1.00
R5715:Smarcc1 UTSW 9 110196367 missense possibly damaging 0.95
R5767:Smarcc1 UTSW 9 110132183 intron probably benign
R5816:Smarcc1 UTSW 9 110197644 missense possibly damaging 0.51
R6969:Smarcc1 UTSW 9 110196320 missense probably damaging 1.00
R7068:Smarcc1 UTSW 9 110185884 missense probably damaging 1.00
R7211:Smarcc1 UTSW 9 110150014 missense probably damaging 0.97
R7903:Smarcc1 UTSW 9 110204266 missense probably benign 0.01
R8190:Smarcc1 UTSW 9 110202534 missense probably benign
R8695:Smarcc1 UTSW 9 110173904 missense probably damaging 0.98
R8842:Smarcc1 UTSW 9 110222131 missense possibly damaging 0.60
T0722:Smarcc1 UTSW 9 110206085 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CACTGCTACATTGTTTTGACTGGG -3'
(R):5'- TGAGGTAGTGACTTATGCATCTAG -3'

Sequencing Primer
(F):5'- CCACTGTGGATTCTAGGGATGACTC -3'
(R):5'- CTAGATTTAGGAATAGGGACTCCTG -3'
Posted On2019-10-17