Incidental Mutation 'R7558:Cactin'
ID584894
Institutional Source Beutler Lab
Gene Symbol Cactin
Ensembl Gene ENSMUSG00000034889
Gene Namecactin, spliceosome C complex subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R7558 (G1)
Quality Score217.468
Status Validated
Chromosome10
Chromosomal Location81321103-81326242 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG at 81321318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000050867] [ENSMUST00000105327] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075] [ENSMUST00000218120]
Predicted Effect probably benign
Transcript: ENSMUST00000045469
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050867
SMART Domains Protein: ENSMUSP00000059533
Gene: ENSMUSG00000034889

DomainStartEndE-ValueType
low complexity region 9 101 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
coiled coil region 157 184 N/A INTRINSIC
low complexity region 186 206 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Pfam:Cactin_mid 292 479 2.1e-68 PFAM
low complexity region 507 524 N/A INTRINSIC
low complexity region 531 558 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
CactinC_cactus 648 772 2.13e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105327
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161586
SMART Domains Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 54 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161869
SMART Domains Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163075
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218120
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Cactin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Cactin APN 10 81324350 missense possibly damaging 0.93
IGL01631:Cactin APN 10 81323224 missense probably benign 0.03
IGL01816:Cactin APN 10 81325865 missense possibly damaging 0.81
IGL02484:Cactin APN 10 81322974 missense probably benign 0.09
IGL03001:Cactin APN 10 81325734 missense probably damaging 1.00
R0241:Cactin UTSW 10 81322652 missense probably benign
R0241:Cactin UTSW 10 81322652 missense probably benign
R0326:Cactin UTSW 10 81322662 missense probably benign 0.01
R0570:Cactin UTSW 10 81323233 missense probably damaging 0.98
R0591:Cactin UTSW 10 81324003 nonsense probably null
R1429:Cactin UTSW 10 81323678 missense probably damaging 1.00
R1444:Cactin UTSW 10 81322436 splice site probably null
R1470:Cactin UTSW 10 81323151 nonsense probably null
R1470:Cactin UTSW 10 81323151 nonsense probably null
R1630:Cactin UTSW 10 81323725 missense probably benign 0.26
R2022:Cactin UTSW 10 81322893 missense possibly damaging 0.94
R3401:Cactin UTSW 10 81325875 missense probably benign 0.07
R3402:Cactin UTSW 10 81325875 missense probably benign 0.07
R3403:Cactin UTSW 10 81325875 missense probably benign 0.07
R5284:Cactin UTSW 10 81323762 missense probably damaging 1.00
R6126:Cactin UTSW 10 81324309 missense possibly damaging 0.61
R6127:Cactin UTSW 10 81324309 missense possibly damaging 0.61
R6907:Cactin UTSW 10 81323444 critical splice donor site probably null
R7339:Cactin UTSW 10 81321318 unclassified probably benign
R7340:Cactin UTSW 10 81321318 unclassified probably benign
R7625:Cactin UTSW 10 81321318 unclassified probably benign
R7627:Cactin UTSW 10 81321318 unclassified probably benign
R7904:Cactin UTSW 10 81325865 missense possibly damaging 0.81
R8825:Cactin UTSW 10 81325658 missense probably damaging 0.99
R8885:Cactin UTSW 10 81321248 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGGACAGTCCTTAGAGCGC -3'
(R):5'- AGTCATTCGGTCCCCTATGC -3'

Sequencing Primer
(F):5'- CGCCGCGCCAAAGGAAAG -3'
(R):5'- ATCTCGGATACTGCCCCG -3'
Posted On2019-10-17