Incidental Mutation 'R7558:Kif5a'
ID584895
Institutional Source Beutler Lab
Gene Symbol Kif5a
Ensembl Gene ENSMUSG00000074657
Gene Namekinesin family member 5A
SynonymsKhc, Kns, Kif5, D10Bwg0738e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127225696-127263348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127248079 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 81 (T81I)
Ref Sequence ENSEMBL: ENSMUSP00000096775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895] [ENSMUST00000218298]
Predicted Effect probably damaging
Transcript: ENSMUST00000099172
AA Change: T81I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: T81I

DomainStartEndE-ValueType
KISc 7 335 7.38e-173 SMART
low complexity region 340 362 N/A INTRINSIC
coiled coil region 408 539 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
coiled coil region 632 800 N/A INTRINSIC
coiled coil region 822 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217895
AA Change: T81I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218298
Meta Mutation Damage Score 0.9720 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Kif5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kif5a APN 10 127239196 missense probably benign
IGL01405:Kif5a APN 10 127245990 missense probably damaging 1.00
IGL01637:Kif5a APN 10 127245368 missense possibly damaging 0.94
IGL01894:Kif5a APN 10 127262779 missense probably benign 0.04
IGL01978:Kif5a APN 10 127245739 missense probably benign
IGL02039:Kif5a APN 10 127233867 missense possibly damaging 0.95
IGL02052:Kif5a APN 10 127243499 missense probably damaging 1.00
IGL02336:Kif5a APN 10 127242696 missense possibly damaging 0.87
IGL02352:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02359:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02834:Kif5a APN 10 127245756 missense probably benign 0.00
IGL03101:Kif5a APN 10 127235609 unclassified probably benign
R0463:Kif5a UTSW 10 127235652 missense probably benign 0.00
R0790:Kif5a UTSW 10 127246009 intron probably benign
R1070:Kif5a UTSW 10 127245406 missense probably benign 0.00
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1502:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R1812:Kif5a UTSW 10 127242010 missense probably benign 0.03
R1837:Kif5a UTSW 10 127236815 nonsense probably null
R1838:Kif5a UTSW 10 127236815 nonsense probably null
R2012:Kif5a UTSW 10 127239175 missense probably benign
R2072:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2073:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2074:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2075:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2440:Kif5a UTSW 10 127231336 missense probably benign 0.34
R3157:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R3688:Kif5a UTSW 10 127242774 missense probably damaging 1.00
R3740:Kif5a UTSW 10 127243468 missense probably damaging 1.00
R4782:Kif5a UTSW 10 127230954 missense probably benign 0.01
R5049:Kif5a UTSW 10 127239839 missense possibly damaging 0.93
R5723:Kif5a UTSW 10 127231029 frame shift probably null
R5764:Kif5a UTSW 10 127231029 frame shift probably null
R5838:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R5903:Kif5a UTSW 10 127230578 missense probably benign 0.00
R6299:Kif5a UTSW 10 127233821 missense probably damaging 1.00
R6384:Kif5a UTSW 10 127242775 missense probably damaging 1.00
R6629:Kif5a UTSW 10 127248254 missense probably damaging 1.00
R7463:Kif5a UTSW 10 127243724 missense probably damaging 0.97
R7567:Kif5a UTSW 10 127237379 missense probably benign 0.00
R7733:Kif5a UTSW 10 127236740 missense probably benign 0.00
R7853:Kif5a UTSW 10 127235668 nonsense probably null
R7869:Kif5a UTSW 10 127243474 missense probably damaging 1.00
R7896:Kif5a UTSW 10 127242004 missense probably benign
R7936:Kif5a UTSW 10 127235668 nonsense probably null
R7952:Kif5a UTSW 10 127243474 missense probably damaging 1.00
R7979:Kif5a UTSW 10 127242004 missense probably benign
Z1177:Kif5a UTSW 10 127229823 missense probably benign 0.00
Z1177:Kif5a UTSW 10 127236967 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGCAGCGTCTGGACTATC -3'
(R):5'- GCCATATGTCTTTGACCGCG -3'

Sequencing Primer
(F):5'- AGCGTCTGGACTATCAATGC -3'
(R):5'- ATATGTCTTTGACCGCGTCTTC -3'
Posted On2019-10-17