Incidental Mutation 'R7558:Kctd11'
ID584897
Institutional Source Beutler Lab
Gene Symbol Kctd11
Ensembl Gene ENSMUSG00000046731
Gene Namepotassium channel tetramerisation domain containing 11
SynonymsRen
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69878261-69881406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69879590 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 207 (H207Q)
Ref Sequence ENSEMBL: ENSMUSP00000059107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000050555] [ENSMUST00000108622] [ENSMUST00000178597]
Predicted Effect probably benign
Transcript: ENSMUST00000001631
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050555
AA Change: H207Q

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000059107
Gene: ENSMUSG00000046731
AA Change: H207Q

DomainStartEndE-ValueType
Pfam:BTB_2 1 73 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108622
SMART Domains Protein: ENSMUSP00000104262
Gene: ENSMUSG00000001588

DomainStartEndE-ValueType
PH 78 174 4.42e-15 SMART
ArfGap 217 339 2.42e-50 SMART
ANK 418 447 4.01e0 SMART
ANK 451 480 3.04e0 SMART
ANK 484 514 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178597
SMART Domains Protein: ENSMUSP00000137492
Gene: ENSMUSG00000094845

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:TMEM95 17 168 3.9e-83 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Kctd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0240:Kctd11 UTSW 11 69879814 missense probably damaging 0.99
R0240:Kctd11 UTSW 11 69879814 missense probably damaging 0.99
R2095:Kctd11 UTSW 11 69879576 missense probably damaging 1.00
R5941:Kctd11 UTSW 11 69879973 missense possibly damaging 0.91
R7072:Kctd11 UTSW 11 69879795 missense probably benign 0.00
R7079:Kctd11 UTSW 11 69880021 missense probably damaging 1.00
R8075:Kctd11 UTSW 11 69880269 unclassified probably benign
R8288:Kctd11 UTSW 11 69880057 missense probably damaging 1.00
R8496:Kctd11 UTSW 11 69880051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTTCATAGCTACCACACCAG -3'
(R):5'- GCCATGCGCAACAGATTTG -3'

Sequencing Primer
(F):5'- TTTCATAGCTACCACACCAGTACTAG -3'
(R):5'- CGCAACAGATTTGGTGTGGCC -3'
Posted On2019-10-17