Incidental Mutation 'R7558:Ppp2r5e'
ID584899
Institutional Source Beutler Lab
Gene Symbol Ppp2r5e
Ensembl Gene ENSMUSG00000021051
Gene Nameprotein phosphatase 2, regulatory subunit B', epsilon
SynonymsB56beta, protein phosphatase 2A subunit beta, 4633401M22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location75450881-75596245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75464992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 319 (V319D)
Ref Sequence ENSEMBL: ENSMUSP00000021447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021447] [ENSMUST00000218012] [ENSMUST00000220035]
Predicted Effect probably damaging
Transcript: ENSMUST00000021447
AA Change: V319D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021447
Gene: ENSMUSG00000021051
AA Change: V319D

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
Pfam:B56 48 453 3.2e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218012
Predicted Effect probably damaging
Transcript: ENSMUST00000220035
AA Change: V285D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Ppp2r5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02602:Ppp2r5e APN 12 75493439 missense probably damaging 1.00
IGL03398:Ppp2r5e APN 12 75462405 missense possibly damaging 0.73
IGL03402:Ppp2r5e APN 12 75464893 missense probably damaging 0.99
R0129:Ppp2r5e UTSW 12 75462390 missense probably damaging 1.00
R0466:Ppp2r5e UTSW 12 75462442 splice site probably benign
R0894:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1452:Ppp2r5e UTSW 12 75469536 splice site probably benign
R1551:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1614:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1693:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1844:Ppp2r5e UTSW 12 75469766 missense possibly damaging 0.81
R1864:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1908:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1909:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1933:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R2181:Ppp2r5e UTSW 12 75462324 missense probably benign 0.08
R3084:Ppp2r5e UTSW 12 75468616 missense probably benign 0.23
R4212:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4213:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4680:Ppp2r5e UTSW 12 75469759 missense probably damaging 1.00
R4761:Ppp2r5e UTSW 12 75593261 missense possibly damaging 0.92
R5147:Ppp2r5e UTSW 12 75469770 missense probably damaging 0.96
R5262:Ppp2r5e UTSW 12 75593271 missense probably damaging 1.00
R5304:Ppp2r5e UTSW 12 75515685 missense possibly damaging 0.75
R5429:Ppp2r5e UTSW 12 75453763 missense probably damaging 0.99
R5439:Ppp2r5e UTSW 12 75493476 missense probably benign
R7225:Ppp2r5e UTSW 12 75468579 missense probably damaging 0.96
R7453:Ppp2r5e UTSW 12 75462342 missense probably damaging 0.99
R8019:Ppp2r5e UTSW 12 75464929 missense not run
Predicted Primers PCR Primer
(F):5'- TAGCCTAATGAGTTCACATGGC -3'
(R):5'- ACACAGTGACTTGCCATAGAATTTG -3'

Sequencing Primer
(F):5'- GCACACATCACTCTGACTCGTG -3'
(R):5'- ACCCCATAACACTTGGGGTTG -3'
Posted On2019-10-17