Incidental Mutation 'R7558:2410089E03Rik'
ID584904
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8225367 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 13 (R13C)
Ref Sequence ENSEMBL: ENSMUSP00000154760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617] [ENSMUST00000228039]
Predicted Effect probably benign
Transcript: ENSMUST00000110617
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000228039
AA Change: R13C
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
R7446:2410089E03Rik UTSW 15 8232080 missense probably damaging 0.98
R7539:2410089E03Rik UTSW 15 8201244 missense probably benign 0.19
R7543:2410089E03Rik UTSW 15 8225392 missense unknown
R7629:2410089E03Rik UTSW 15 8227067 nonsense probably null
R7635:2410089E03Rik UTSW 15 8226920 missense probably benign 0.01
R7644:2410089E03Rik UTSW 15 8223127 missense probably benign 0.00
R7705:2410089E03Rik UTSW 15 8182252 missense probably damaging 1.00
R7752:2410089E03Rik UTSW 15 8269706 missense unknown
R7754:2410089E03Rik UTSW 15 8243826 missense possibly damaging 0.53
R7757:2410089E03Rik UTSW 15 8252227 missense unknown
R7836:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7875:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7901:2410089E03Rik UTSW 15 8269706 missense unknown
R7919:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7958:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7984:2410089E03Rik UTSW 15 8269706 missense unknown
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGTGGAAACAGACTGTGATTATG -3'
(R):5'- TGAGGTCTCAAAACGGTGTG -3'

Sequencing Primer
(F):5'- CAGACTGTGATTATGAGCTAAGTGC -3'
(R):5'- AAACGGTGTGCCTACATTGC -3'
Posted On2019-10-17