Incidental Mutation 'R7558:Chrd'
ID584907
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Namechordin
SynonymsChd
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20733127-20742384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20738554 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 641 (V641E)
Ref Sequence ENSEMBL: ENSMUSP00000007171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000231698] [ENSMUST00000232646]
Predicted Effect probably damaging
Transcript: ENSMUST00000007171
AA Change: V641E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: V641E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115423
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115437
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153299
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
Predicted Effect probably benign
Transcript: ENSMUST00000231698
Predicted Effect probably damaging
Transcript: ENSMUST00000232646
AA Change: V663E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20741225 missense possibly damaging 0.89
IGL01486:Chrd APN 16 20734140 splice site probably null
IGL02120:Chrd APN 16 20734541 missense probably damaging 1.00
IGL02370:Chrd APN 16 20735791 missense possibly damaging 0.52
IGL02675:Chrd APN 16 20739949 splice site probably benign
IGL02678:Chrd APN 16 20734020 missense probably damaging 1.00
IGL02874:Chrd APN 16 20735196 missense probably damaging 1.00
ANU74:Chrd UTSW 16 20741319 missense possibly damaging 0.88
PIT1430001:Chrd UTSW 16 20738998 critical splice donor site probably null
R0016:Chrd UTSW 16 20734308 missense possibly damaging 0.85
R0230:Chrd UTSW 16 20733275 missense probably benign 0.25
R0605:Chrd UTSW 16 20735439 missense probably damaging 1.00
R0831:Chrd UTSW 16 20741309 missense probably damaging 0.99
R1501:Chrd UTSW 16 20737533 missense probably damaging 1.00
R1659:Chrd UTSW 16 20735831 missense probably damaging 0.96
R1766:Chrd UTSW 16 20737441 missense probably damaging 1.00
R1823:Chrd UTSW 16 20741347 splice site probably benign
R3001:Chrd UTSW 16 20737445 nonsense probably null
R3002:Chrd UTSW 16 20737445 nonsense probably null
R3874:Chrd UTSW 16 20738910 missense probably damaging 0.99
R4319:Chrd UTSW 16 20737048 missense probably damaging 0.99
R4587:Chrd UTSW 16 20738575 missense possibly damaging 0.58
R4707:Chrd UTSW 16 20738808 missense possibly damaging 0.58
R4857:Chrd UTSW 16 20738758 missense possibly damaging 0.79
R5204:Chrd UTSW 16 20736072 missense probably benign 0.02
R5364:Chrd UTSW 16 20733148 start codon destroyed probably null 0.03
R5445:Chrd UTSW 16 20738910 missense possibly damaging 0.74
R5611:Chrd UTSW 16 20738974 missense probably damaging 1.00
R5940:Chrd UTSW 16 20734586 missense probably null 0.01
R6004:Chrd UTSW 16 20735237 missense possibly damaging 0.92
R6767:Chrd UTSW 16 20738626 missense probably benign 0.00
R6798:Chrd UTSW 16 20734306 missense probably damaging 1.00
R6801:Chrd UTSW 16 20735747 missense possibly damaging 0.68
R6823:Chrd UTSW 16 20734736 missense probably damaging 1.00
R6999:Chrd UTSW 16 20735652 missense probably benign
R7069:Chrd UTSW 16 20739433 missense probably damaging 1.00
R7136:Chrd UTSW 16 20734522 missense possibly damaging 0.82
R7273:Chrd UTSW 16 20741566 missense probably benign 0.32
X0063:Chrd UTSW 16 20737564 critical splice donor site probably null
Z1088:Chrd UTSW 16 20741255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGAGGACAGTGCAGTTGC -3'
(R):5'- AACATGTGTTAGGATCTCGGGG -3'

Sequencing Primer
(F):5'- TCTTGCCAGTGATAAACATGAAGCC -3'
(R):5'- TTAGGATCTCGGGGTCTCC -3'
Posted On2019-10-17