Incidental Mutation 'R7558:Tmprss15'
ID584909
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79003414 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 609 (I609V)
Ref Sequence ENSEMBL: ENSMUSP00000023566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023566
AA Change: I609V

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: I609V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060402
AA Change: I594V

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: I594V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 intron probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATCTGCGTCAGTGTGCTGTC -3'
(R):5'- TTTGCACTGTGGAAAGATCATCCC -3'

Sequencing Primer
(F):5'- CAGTGTGCTGTCTCTGTAAGTCAAG -3'
(R):5'- TGTGGAAAGATCATCCCAGTCAC -3'
Posted On2019-10-17