Mutagenetix > Incidental Mutation

Incidental Mutation 'R0617:Svil'

58491

Institutional Source

Beutler Lab

Gene Symbol

Svil

Ensembl Gene

ENSMUSG00000024236

Gene Name

supervillin

Synonyms

B430302E16Rik

MMRRC Submission

038806-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R0617 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4920540-5119299 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5117002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2059 (S2059P)

Ref Sequence

ENSEMBL: ENSMUSP00000119803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]

AlphaFold

Q8K4L3

Predicted Effect

probably damaging
Transcript: ENSMUST00000025079
AA Change: S2059P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: S2059P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125512

SMART Domains

Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	168	178	N/A	INTRINSIC
GEL	384	483	4.58e-22	SMART
GEL	508	625	4.03e-1	SMART
Blast:GEL	695	733	1e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000126977
AA Change: S2059P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: S2059P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127297
AA Change: S1945P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: S1945P

Domain	Start	End	E-Value	Type
low complexity region	1067	1077	N/A	INTRINSIC
GEL	1283	1382	4.58e-22	SMART
GEL	1407	1524	4.03e-1	SMART
GEL	1594	1704	2.93e-20	SMART
low complexity region	1711	1717	N/A	INTRINSIC
GEL	1723	1824	1.72e-17	SMART
GEL	1857	1964	1.37e0	SMART
VHP	2021	2056	1.15e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129543

Predicted Effect

probably benign
Transcript: ENSMUST00000131609

SMART Domains

Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	2.9e-24	SMART
GEL	1521	1638	2.5e-3	SMART
GEL	1708	1818	1.9e-22	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.1e-19	SMART
low complexity region	1965	1974	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140448
AA Change: S2059P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: S2059P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143254
AA Change: S1655P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: S1655P

Domain	Start	End	E-Value	Type
low complexity region	777	787	N/A	INTRINSIC
GEL	993	1092	4.58e-22	SMART
GEL	1117	1234	4.03e-1	SMART
GEL	1304	1414	2.93e-20	SMART
low complexity region	1421	1427	N/A	INTRINSIC
GEL	1433	1534	1.72e-17	SMART
GEL	1567	1674	1.37e0	SMART
VHP	1731	1766	1.15e-18	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000146723
AA Change: S163P

SMART Domains

Protein: ENSMUSP00000115591
Gene: ENSMUSG00000024236
AA Change: S163P

Domain	Start	End	E-Value	Type
Blast:GEL	2	37	1e-17	BLAST
SCOP:d1d0na6	53	168	3e-19	SMART
Blast:GEL	63	169	1e-72	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000210707
AA Change: S2146P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

98% (130/133)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	C	A	19: 11,112,400	L40F	probably damaging	Het
4930555F03Rik	A	T	8: 49,500,492		noncoding transcript	Het
A630073D07Rik	T	C	6: 132,626,737		probably benign	Het
Abca16	G	A	7: 120,433,611		probably benign	Het
Abca5	A	T	11: 110,279,689	D1265E	probably damaging	Het
Abcf1	C	T	17: 35,961,187	V312I	probably benign	Het
Abhd12	T	A	2: 150,846,365		probably null	Het
Adam23	A	G	1: 63,543,147	H318R	probably benign	Het
Adcy2	T	A	13: 68,678,606	K660*	probably null	Het
Adgrf3	T	C	5: 30,195,080	T972A	probably benign	Het
Adipoq	T	A	16: 23,155,410	D62E	probably damaging	Het
Akap2	T	C	4: 57,829,434		probably benign	Het
Alk	G	T	17: 72,603,583	P43T	probably damaging	Het
Arap2	AT	ATT	5: 62,649,907		probably benign	Het
Arhgef28	G	T	13: 97,970,355	T687K	probably benign	Het
Arrb1	T	C	7: 99,594,677	L278P	probably damaging	Het
Atad2b	C	A	12: 4,937,401	D76E	probably benign	Het
Atm	A	T	9: 53,458,941	Y2290*	probably null	Het
Atrn	T	A	2: 130,995,085		probably null	Het
Bpifb1	A	G	2: 154,212,947	D253G	possibly damaging	Het
Bpifb9b	C	T	2: 154,319,625	T559M	probably benign	Het
Bsn	T	C	9: 108,107,240	E3205G	unknown	Het
Cacna1c	T	C	6: 118,602,213	Y1599C	probably damaging	Het
Ccdc40	A	G	11: 119,242,804	D590G	probably damaging	Het
Ccdc68	A	G	18: 69,946,552		probably null	Het
Ccdc97	G	A	7: 25,714,420	R279C	probably damaging	Het
Ccm2l	A	G	2: 153,070,900	T120A	probably damaging	Het
Cfap54	T	C	10: 92,829,650		probably benign	Het
Cfh	A	G	1: 140,100,883	S1043P	probably benign	Het
Chil3	T	C	3: 106,155,756	K173E	probably benign	Het
Cib2	T	C	9: 54,554,496	D26G	possibly damaging	Het
Col24a1	T	C	3: 145,314,120	V84A	probably damaging	Het
Csn3	T	C	5: 87,929,871	Y79H	probably benign	Het
Ddx47	T	A	6: 135,017,122	V149E	probably damaging	Het
Dennd5b	A	T	6: 149,033,262		probably benign	Het
Desi1	T	C	15: 81,998,198	N109D	probably damaging	Het
Fam13c	T	C	10: 70,536,352		probably benign	Het
Fam234a	A	T	17: 26,216,617	D264E	probably benign	Het
Fanca	A	G	8: 123,288,070	F831S	probably damaging	Het
Fancm	C	T	12: 65,097,317	R518*	probably null	Het
Fat2	A	G	11: 55,311,843	V135A	possibly damaging	Het
Fbxl17	A	C	17: 63,384,992	F42V	probably damaging	Het
Fgd3	A	T	13: 49,264,697	V631E	possibly damaging	Het
Fhod3	G	A	18: 25,112,679		probably benign	Het
Focad	T	C	4: 88,121,288		probably benign	Het
Foxn4	C	A	5: 114,261,068		probably benign	Het
Gm1673	T	C	5: 33,983,552		probably benign	Het
Gm2381	A	T	7: 42,819,978	C241S	probably damaging	Het
Gm6483	T	G	8: 19,693,709	F117V	probably damaging	Het
Hectd4	T	C	5: 121,343,232		probably benign	Het
Hecw1	T	A	13: 14,280,442	Q676L	probably benign	Het
Hipk2	G	A	6: 38,747,485	R437C	possibly damaging	Het
Ifnar1	T	C	16: 91,501,682	Y396H	probably damaging	Het
Ints5	A	T	19: 8,896,019	K447N	probably damaging	Het
Iqsec1	T	C	6: 90,689,970	Y495C	probably damaging	Het
Itga5	C	T	15: 103,356,315		probably null	Het
Kcnk4	T	A	19: 6,928,160		probably benign	Het
Kmo	A	G	1: 175,647,190	T174A	possibly damaging	Het
Krt36	T	C	11: 100,102,275	D458G	probably damaging	Het
Krtap16-1	G	T	11: 99,986,495	P28T	probably damaging	Het
Lama3	T	C	18: 12,419,258		probably null	Het
Lrrc9	T	C	12: 72,483,014	S920P	probably damaging	Het
Lrrk2	A	T	15: 91,752,278	Y1485F	probably benign	Het
Mical1	C	T	10: 41,481,315	A372V	probably damaging	Het
Mtr	C	T	13: 12,221,432	R636Q	probably benign	Het
Muc4	A	T	16: 32,752,107	T662S	possibly damaging	Het
Myo10	G	A	15: 25,738,005	V546M	probably damaging	Het
Nbeal1	G	A	1: 60,281,832	W2034*	probably null	Het
Nhlrc3	T	C	3: 53,458,623	T150A	probably damaging	Het
Nkx2-1	T	C	12: 56,534,855	H69R	possibly damaging	Het
Nlrp4g	A	T	9: 124,349,540		noncoding transcript	Het
Nod2	A	G	8: 88,653,231	N120S	probably benign	Het
Nol8	T	C	13: 49,654,445	F46L	possibly damaging	Het
Ntrk1	T	C	3: 87,783,933	D308G	possibly damaging	Het
Olfr1036	A	G	2: 86,075,141	M134V	probably benign	Het
Olfr1124	A	G	2: 87,434,661	D58G	probably damaging	Het
Olfr1196	A	G	2: 88,700,696	V211A	probably damaging	Het
Olfr1459	T	C	19: 13,146,363	M99V	probably benign	Het
Olfr1477	C	A	19: 13,502,536	N64K	probably damaging	Het
Olfr313	T	C	11: 58,817,149	V47A	probably damaging	Het
Olfr466	A	T	13: 65,152,878	Y218F	possibly damaging	Het
Olfr640	A	T	7: 104,021,989	S110T	probably damaging	Het
Oog3	A	T	4: 144,160,214	V112D	probably benign	Het
Pcdhb8	C	T	18: 37,357,047	R593C	probably benign	Het
Pgm3	A	G	9: 86,556,190		probably null	Het
Pirt	T	A	11: 66,926,172	V103E	probably damaging	Het
Plxnc1	T	A	10: 94,799,368	D1332V	probably damaging	Het
Ppfia4	A	T	1: 134,328,780	V122E	probably damaging	Het
Pramef17	A	G	4: 143,993,518		probably benign	Het
Prmt2	C	T	10: 76,208,683		probably benign	Het
Prrc2a	G	T	17: 35,153,560	P1702T	probably damaging	Het
Prss39	A	T	1: 34,500,198	H173L	probably damaging	Het
Rabl6	A	G	2: 25,586,866		probably null	Het
Rb1cc1	T	A	1: 6,248,790	I794K	possibly damaging	Het
Reln	T	C	5: 21,920,537	D2716G	probably damaging	Het
Sbf2	ACC	AC	7: 110,330,683		probably null	Het
Sema6d	T	A	2: 124,660,745	F583L	possibly damaging	Het
Setx	T	A	2: 29,146,807	H1101Q	possibly damaging	Het
Sis	A	G	3: 72,965,605	C67R	probably damaging	Het
Skint1	T	A	4: 112,029,399		probably benign	Het
Smg6	C	A	11: 75,162,931	T1413K	probably benign	Het
Spata31d1a	A	T	13: 59,702,259	I685N	possibly damaging	Het
Spef2	T	A	15: 9,592,758	N1499I	probably damaging	Het
Stk11ip	T	A	1: 75,532,288		probably null	Het
Stxbp1	A	C	2: 32,802,783	I407S	probably damaging	Het
Syne1	C	T	10: 5,350,933	V932M	probably damaging	Het
Tacc1	A	C	8: 25,178,004		probably benign	Het
Tbc1d13	C	A	2: 30,135,564		probably benign	Het
Tbc1d15	A	C	10: 115,239,299	D59E	probably damaging	Het
Tcaf2	A	G	6: 42,642,511	F194S	probably damaging	Het
Terf2ip	T	A	8: 112,011,495	M5K	probably benign	Het
Tgfbr2	A	T	9: 116,158,320	D40E	probably benign	Het
Tm4sf5	T	A	11: 70,510,669	S165T	probably damaging	Het
Tmprss3	A	T	17: 31,193,912	C129S	probably damaging	Het
Tmx2	T	C	2: 84,672,396	D256G	probably benign	Het
Tnr	A	G	1: 159,868,103	D532G	probably damaging	Het
Tnrc18	T	A	5: 142,776,739	H465L	unknown	Het
Togaram2	A	T	17: 71,700,509	Q350L	possibly damaging	Het
Topaz1	G	A	9: 122,749,906	C627Y	possibly damaging	Het
Tpx2	A	T	2: 152,873,138	Q93L	probably benign	Het
Trim54	T	C	5: 31,136,182		probably null	Het
Troap	T	A	15: 99,082,660	C574S	probably damaging	Het
Ubr4	T	C	4: 139,479,062		probably null	Het
Vmn2r51	A	G	7: 10,100,469	V214A	possibly damaging	Het
Vmn2r66	A	T	7: 84,995,276	M642K	probably benign	Het
Vwa5a	T	A	9: 38,723,895	I232N	probably damaging	Het
Zcchc6	A	T	13: 59,816,855		probably null	Het
Zfp820	A	T	17: 21,819,704	S214R	probably damaging	Het
Zfp955b	A	T	17: 33,305,463	S43R	probably damaging	Het
Zgrf1	C	T	3: 127,588,038	T1162M	probably benign	Het

Other mutations in Svil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Svil	APN	18	5099045	missense	probably benign	0.27
IGL00840:Svil	APN	18	5063555	missense	probably benign
IGL01329:Svil	APN	18	5064501	missense	probably benign
IGL01446:Svil	APN	18	5062385	missense	probably damaging	1.00
IGL02068:Svil	APN	18	5092899	missense	probably damaging	1.00
IGL02223:Svil	APN	18	5105879	splice site	probably benign
IGL02428:Svil	APN	18	5118203	missense	probably damaging	1.00
IGL02429:Svil	APN	18	5118369	missense	probably benign	0.00
IGL02479:Svil	APN	18	5099476	missense	probably damaging	1.00
IGL02560:Svil	APN	18	5049379	missense	probably benign	0.00
IGL02652:Svil	APN	18	5114531	missense	probably damaging	1.00
IGL03291:Svil	APN	18	5056150	nonsense	probably null
R3779_Svil_985	UTSW	18	5090855	missense	probably damaging	0.97
R5433_Svil_176	UTSW	18	5059294	missense	probably damaging	0.99
R6062_Svil_873	UTSW	18	5106724	missense	probably damaging	1.00
BB002:Svil	UTSW	18	5118357	missense	probably benign	0.00
BB012:Svil	UTSW	18	5118357	missense	probably benign	0.00
IGL03055:Svil	UTSW	18	5108615	missense	probably damaging	1.00
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0266:Svil	UTSW	18	5099063	splice site	probably benign
R0281:Svil	UTSW	18	5094582	missense	probably damaging	1.00
R0442:Svil	UTSW	18	5046870	missense	probably damaging	1.00
R0549:Svil	UTSW	18	5064566	missense	possibly damaging	0.79
R0801:Svil	UTSW	18	5099443	missense	probably benign	0.00
R0894:Svil	UTSW	18	5097494	missense	probably damaging	1.00
R1053:Svil	UTSW	18	5056690	missense	probably benign	0.16
R1065:Svil	UTSW	18	5063777	splice site	probably benign
R1080:Svil	UTSW	18	5058147	missense	possibly damaging	0.79
R1199:Svil	UTSW	18	5059217	splice site	probably benign
R1472:Svil	UTSW	18	5048950	missense	probably benign	0.09
R1480:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R1544:Svil	UTSW	18	5046817	missense	possibly damaging	0.93
R1626:Svil	UTSW	18	5117099	critical splice donor site	probably null
R1691:Svil	UTSW	18	5056336	missense	probably benign	0.06
R1812:Svil	UTSW	18	5097545	missense	probably damaging	1.00
R1826:Svil	UTSW	18	5063383	missense	probably benign	0.01
R1842:Svil	UTSW	18	5062373	missense	probably damaging	1.00
R1884:Svil	UTSW	18	5094640	missense	possibly damaging	0.94
R1945:Svil	UTSW	18	5117059	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099534	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099615	missense	probably damaging	1.00
R2232:Svil	UTSW	18	5046640	start codon destroyed	probably null	0.98
R2398:Svil	UTSW	18	5060613	splice site	probably null
R3076:Svil	UTSW	18	5116055	missense	probably damaging	1.00
R3777:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3779:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3797:Svil	UTSW	18	5060534	missense	probably benign	0.29
R4077:Svil	UTSW	18	5063522	missense	probably benign	0.03
R4350:Svil	UTSW	18	5118154	missense	probably damaging	1.00
R4379:Svil	UTSW	18	5046909	missense	probably damaging	1.00
R4488:Svil	UTSW	18	5049067	missense	probably damaging	1.00
R4777:Svil	UTSW	18	5088813	missense	probably damaging	0.99
R4825:Svil	UTSW	18	5114564	missense	probably damaging	1.00
R4921:Svil	UTSW	18	5108631	missense	probably damaging	1.00
R4969:Svil	UTSW	18	5095516	missense	probably damaging	1.00
R4975:Svil	UTSW	18	5054025	missense	possibly damaging	0.61
R4990:Svil	UTSW	18	5056810	missense	probably benign	0.05
R4991:Svil	UTSW	18	5056810	missense	probably benign	0.05
R5061:Svil	UTSW	18	5048954	missense	probably benign	0.02
R5271:Svil	UTSW	18	5062329	missense	probably benign	0.45
R5362:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R5433:Svil	UTSW	18	5059294	missense	probably damaging	0.99
R5677:Svil	UTSW	18	5046823	nonsense	probably null
R5850:Svil	UTSW	18	5098900	splice site	probably null
R5868:Svil	UTSW	18	5056854	splice site	probably null
R5871:Svil	UTSW	18	5103669	splice site	probably null
R5876:Svil	UTSW	18	5082828	missense	probably damaging	1.00
R6061:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6062:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6063:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6065:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6066:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6114:Svil	UTSW	18	5108639	missense	probably damaging	1.00
R6115:Svil	UTSW	18	5108675	missense	probably damaging	0.99
R6117:Svil	UTSW	18	5116016	missense	probably damaging	1.00
R6302:Svil	UTSW	18	5057432	missense	probably benign	0.13
R6418:Svil	UTSW	18	5040171	missense	probably benign	0.26
R6441:Svil	UTSW	18	5049323	missense	probably benign
R6446:Svil	UTSW	18	5057323	missense	probably benign	0.09
R6455:Svil	UTSW	18	5056629	missense	possibly damaging	0.89
R6545:Svil	UTSW	18	5108621	missense	probably benign	0.00
R6692:Svil	UTSW	18	5082853	missense	probably damaging	1.00
R6730:Svil	UTSW	18	5049311	missense	probably benign	0.17
R6763:Svil	UTSW	18	5056437	missense	probably damaging	0.99
R6870:Svil	UTSW	18	5063231	missense	possibly damaging	0.86
R6916:Svil	UTSW	18	5114682	utr 3 prime	probably benign
R7134:Svil	UTSW	18	5116080	missense	probably damaging	1.00
R7190:Svil	UTSW	18	5092937	missense	probably benign	0.01
R7213:Svil	UTSW	18	5094574	missense	probably damaging	0.99
R7249:Svil	UTSW	18	5056270	missense	probably benign	0.01
R7249:Svil	UTSW	18	5062247	missense	probably damaging	0.99
R7421:Svil	UTSW	18	5056109	missense	probably benign	0.18
R7571:Svil	UTSW	18	5114636	missense	probably damaging	1.00
R7574:Svil	UTSW	18	5095188	missense	probably benign	0.16
R7645:Svil	UTSW	18	5099663	missense	probably damaging	1.00
R7925:Svil	UTSW	18	5118357	missense	probably benign	0.00
R8113:Svil	UTSW	18	5062385	missense	probably damaging	1.00
R8263:Svil	UTSW	18	5108679	missense	probably damaging	1.00
R8485:Svil	UTSW	18	5064566	missense	probably benign	0.03
R8491:Svil	UTSW	18	5106678	missense	probably damaging	1.00
R8752:Svil	UTSW	18	5060366	intron	probably benign
R8774:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8774-TAIL:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8780:Svil	UTSW	18	5063449	missense	probably benign	0.00
R8787:Svil	UTSW	18	5059332	nonsense	probably null
R8790:Svil	UTSW	18	5056098	missense	possibly damaging	0.82
R8974:Svil	UTSW	18	5099650	missense	probably damaging	1.00
R9029:Svil	UTSW	18	5056239	missense	probably benign
R9072:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9073:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9079:Svil	UTSW	18	5056308	missense	probably benign	0.31
R9181:Svil	UTSW	18	5090833	missense	possibly damaging	0.75
R9363:Svil	UTSW	18	5037155	missense	probably benign	0.02
R9377:Svil	UTSW	18	5057294	missense	probably benign	0.06
R9381:Svil	UTSW	18	5099013	missense	probably benign	0.06
R9389:Svil	UTSW	18	5090811	missense	possibly damaging	0.52
R9566:Svil	UTSW	18	5099661	missense	probably damaging	1.00
R9607:Svil	UTSW	18	5058126	missense	possibly damaging	0.92
R9716:Svil	UTSW	18	5062370	missense	probably damaging	1.00
R9801:Svil	UTSW	18	5049062	missense	probably damaging	1.00
X0065:Svil	UTSW	18	5062317	missense	probably damaging	1.00
Z1177:Svil	UTSW	18	5062344	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTTTCCAGACAGCCTTCTGTCC -3'
(R):5'- TGAGCTTGCTCACCATCATGCAC -3'

Sequencing Primer
(F):5'- TCAGATAAACAGCACCTGTGTG -3'
(R):5'- TGCCGATGAGCAACAATAAATGC -3'

Posted On

2013-07-11