Mutagenetix > Incidental Mutations

Incidental Mutation 'R7558:Dsg2'

584911

Institutional Source

Beutler Lab

Gene Symbol

Dsg2

Ensembl Gene

ENSMUSG00000044393

Gene Name

desmoglein 2

Synonyms

D18Ertd293e

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R7558 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20558074-20604521 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20594234 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 613 (V613I)

Ref Sequence

ENSEMBL: ENSMUSP00000057096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059787]

Predicted Effect

probably benign
Transcript: ENSMUST00000059787
AA Change: V613I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: V613I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130296

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	G	T	11: 23,516,285		probably null	Het
2410089E03Rik	C	T	15: 8,225,367	R13C	unknown	Het
Adgrg6	A	T	10: 14,431,607	M817K	probably damaging	Het
Adh6b	T	A	3: 138,352,536	D53E	probably benign	Het
Ap3d1	A	G	10: 80,722,921	V283A	possibly damaging	Het
Arhgap21	A	G	2: 20,855,610	Y1329H	probably damaging	Het
B3gnt9	T	C	8: 105,254,672	Y28C	probably benign	Het
Cactin	CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG	CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG	10: 81,321,318		probably benign	Het
Chrd	T	A	16: 20,738,554	V641E	probably damaging	Het
Clvs2	A	T	10: 33,543,464	I198N	probably damaging	Het
Dbndd2	T	C	2: 164,490,216	S120P	probably benign	Het
Dsp	A	G	13: 38,168,766	M207V	probably benign	Het
Fignl2	T	C	15: 101,054,383	E6G	probably damaging	Het
Fmod	A	G	1: 134,040,993	Y257C	probably benign	Het
Foxk2	T	C	11: 121,288,058	S239P	probably benign	Het
Fstl5	C	T	3: 76,429,785	T217I	possibly damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gm45140	G	A	6: 87,821,529	S34F		Het
H2-Q6	A	G	17: 35,425,619	E128G	probably benign	Het
Hmmr	A	G	11: 40,733,329	F11L	probably damaging	Het
Igfbpl1	G	T	4: 45,813,497	N239K	probably damaging	Het
Itpr2	G	T	6: 146,390,865	D443E	probably damaging	Het
Kcnt2	A	T	1: 140,523,190	I736F	probably damaging	Het
Kctd11	A	T	11: 69,879,590	H207Q	probably benign	Het
Kif16b	A	T	2: 142,758,826	D462E	probably damaging	Het
Kif5a	G	A	10: 127,248,079	T81I	probably damaging	Het
Lrp1b	T	C	2: 41,341,936	D1174G		Het
Lrrc8b	G	T	5: 105,481,711	W641L	probably damaging	Het
Malt1	T	C	18: 65,462,834	C438R	probably damaging	Het
March8	T	C	6: 116,403,565	F126L	possibly damaging	Het
Nalcn	C	A	14: 123,486,385		probably null	Het
Nyap2	A	T	1: 81,269,373	T679S	probably benign	Het
Olfr1469	T	A	19: 13,410,991	C141S	probably damaging	Het
Olfr503	C	G	7: 108,544,721	Y65*	probably null	Het
Otog	C	A	7: 46,303,160	P419Q	probably damaging	Het
Pabpc4	T	G	4: 123,294,620	S341A	possibly damaging	Het
Pikfyve	T	A	1: 65,272,623	H2006Q	probably benign	Het
Ppp2r5e	A	T	12: 75,464,992	V319D	probably damaging	Het
Ptk2b	T	C	14: 66,154,179	S969G	possibly damaging	Het
Rasal2	G	A	1: 157,175,836	R436C	probably damaging	Het
Rpap1	A	T	2: 119,771,254	F742I	probably benign	Het
Ryr2	G	A	13: 11,799,825	T687M	probably damaging	Het
Sec16a	A	T	2: 26,439,734	F7L		Het
Slc14a2	A	G	18: 78,192,119	I143T	probably benign	Het
Slc22a26	T	A	19: 7,785,286	M430L	possibly damaging	Het
Smarcc1	C	A	9: 110,147,116	T157K	probably damaging	Het
Tmem87a	A	G	2: 120,374,510	I375T	probably benign	Het
Tmprss15	T	C	16: 79,003,414	I609V	possibly damaging	Het
Tnk2	C	A	16: 32,680,085	Q739K	probably benign	Het
Trio	T	A	15: 27,831,394	I1340F	possibly damaging	Het
Trpm6	T	C	19: 18,778,665	F91L	probably damaging	Het
Vax1	T	C	19: 59,169,984	T16A	unknown	Het
Vps13d	T	G	4: 145,154,580	H1481P		Het
Zbtb7a	A	G	10: 81,148,435	*570W	probably null	Het

Other mutations in Dsg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dsg2	APN	18	20601769	missense	probably benign	0.10
IGL00979:Dsg2	APN	18	20582767	missense	probably damaging	0.99
IGL01081:Dsg2	APN	18	20589942	unclassified	probably benign
IGL01358:Dsg2	APN	18	20601793	missense	probably damaging	0.98
IGL02002:Dsg2	APN	18	20579176	missense	probably damaging	1.00
IGL02263:Dsg2	APN	18	20590020	missense	possibly damaging	0.70
IGL02410:Dsg2	APN	18	20602132	missense	probably benign	0.04
IGL02553:Dsg2	APN	18	20592410	missense	probably damaging	1.00
IGL03036:Dsg2	APN	18	20579077	missense	probably damaging	0.99
dissolute	UTSW	18	20595951	splice site	probably null
Dysjunction	UTSW	18	20582939	nonsense	probably null
weg	UTSW	18	20580651	nonsense	probably null
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0112:Dsg2	UTSW	18	20583042	missense	probably benign	0.02
R0305:Dsg2	UTSW	18	20582695	splice site	probably benign
R0380:Dsg2	UTSW	18	20582939	nonsense	probably null
R0401:Dsg2	UTSW	18	20592508	splice site	probably benign
R0421:Dsg2	UTSW	18	20579391	missense	probably damaging	1.00
R0578:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R0667:Dsg2	UTSW	18	20573499	missense	possibly damaging	0.50
R1223:Dsg2	UTSW	18	20573493	missense	probably benign	0.23
R1433:Dsg2	UTSW	18	20582723	missense	probably damaging	0.98
R1543:Dsg2	UTSW	18	20594211	missense	probably benign	0.33
R1730:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1783:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1946:Dsg2	UTSW	18	20580548	missense	probably damaging	1.00
R1991:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R1992:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R2027:Dsg2	UTSW	18	20583004	unclassified	probably null
R2109:Dsg2	UTSW	18	20592289	missense	probably benign	0.00
R2143:Dsg2	UTSW	18	20579161	missense	probably damaging	1.00
R2201:Dsg2	UTSW	18	20596054	missense	probably damaging	1.00
R2343:Dsg2	UTSW	18	20602298	missense	probably damaging	0.99
R2937:Dsg2	UTSW	18	20579128	missense	probably damaging	1.00
R3710:Dsg2	UTSW	18	20602117	missense	probably damaging	1.00
R3734:Dsg2	UTSW	18	20601947	missense	probably benign	0.41
R3773:Dsg2	UTSW	18	20591862	missense	probably damaging	1.00
R4176:Dsg2	UTSW	18	20580663	missense	probably benign	0.25
R4213:Dsg2	UTSW	18	20598514	missense	probably benign	0.01
R4299:Dsg2	UTSW	18	20595951	splice site	probably null
R4515:Dsg2	UTSW	18	20601387	missense	probably benign
R4649:Dsg2	UTSW	18	20602245	missense	possibly damaging	0.56
R4940:Dsg2	UTSW	18	20579430	missense	probably damaging	1.00
R4949:Dsg2	UTSW	18	20590184	missense	probably damaging	1.00
R4998:Dsg2	UTSW	18	20601521	missense	probably benign	0.26
R5078:Dsg2	UTSW	18	20596083	critical splice donor site	probably null
R5155:Dsg2	UTSW	18	20598658	missense	possibly damaging	0.67
R5398:Dsg2	UTSW	18	20579133	missense	probably benign	0.45
R5503:Dsg2	UTSW	18	20580651	nonsense	probably null
R6133:Dsg2	UTSW	18	20590089	missense	probably benign	0.00
R6163:Dsg2	UTSW	18	20598669	critical splice donor site	probably null
R6226:Dsg2	UTSW	18	20579449	missense	probably damaging	0.98
R6228:Dsg2	UTSW	18	20594293	critical splice donor site	probably null
R6241:Dsg2	UTSW	18	20590217	splice site	probably null
R6482:Dsg2	UTSW	18	20601314	missense	possibly damaging	0.69
R6524:Dsg2	UTSW	18	20583036	missense	probably damaging	1.00
R6856:Dsg2	UTSW	18	20601802	missense	probably damaging	0.98
R7058:Dsg2	UTSW	18	20592275	missense	probably benign	0.00
R7108:Dsg2	UTSW	18	20601863	missense	probably damaging	1.00
R7149:Dsg2	UTSW	18	20579454	missense	probably damaging	0.98
R7207:Dsg2	UTSW	18	20601459	missense	probably damaging	0.99
R7256:Dsg2	UTSW	18	20591931	missense	possibly damaging	0.96
R7315:Dsg2	UTSW	18	20579160	missense	probably damaging	0.97
R7471:Dsg2	UTSW	18	20580618	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GCCACATTAAGACCTGTCTCTC -3'
(R):5'- TGCAAAGCACACTTGGATTGG -3'

Sequencing Primer
(F):5'- AAGACCTGTCTCTCCTCTCAACAG -3'
(R):5'- GCACACTTGGATTGGAATAAACTG -3'

Posted On

2019-10-17