Incidental Mutation 'R7558:Malt1'
ID584912
Institutional Source Beutler Lab
Gene Symbol Malt1
Ensembl Gene ENSMUSG00000032688
Gene NameMALT1 paracaspase
Synonymsparacaspase, D430033E09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172833

Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location65430962-65478823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65462834 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 438 (C438R)
Ref Sequence ENSEMBL: ENSMUSP00000048376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049248] [ENSMUST00000224056]
Predicted Effect probably damaging
Transcript: ENSMUST00000049248
AA Change: C438R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048376
Gene: ENSMUSG00000032688
AA Change: C438R

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
PDB:2G7R|B 52 132 3e-29 PDB
IGc2 145 203 8.19e-9 SMART
IGc2 248 306 2.88e-4 SMART
Pfam:Peptidase_C14 340 557 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224056
AA Change: C449R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Malt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Malt1 APN 18 65448963 nonsense probably null
IGL01354:Malt1 APN 18 65475191 missense probably damaging 1.00
IGL01514:Malt1 APN 18 65476400 missense possibly damaging 0.74
IGL01968:Malt1 APN 18 65449016 missense probably benign 0.08
bryce_canyon UTSW 18 65462915 critical splice donor site probably null
mousebird UTSW 18 65475260 critical splice donor site probably null
yellowstone UTSW 18 65458200 missense probably damaging 1.00
H8930:Malt1 UTSW 18 65462815 nonsense probably null
R0319:Malt1 UTSW 18 65462915 critical splice donor site probably null
R0512:Malt1 UTSW 18 65458200 missense probably damaging 1.00
R0748:Malt1 UTSW 18 65475260 critical splice donor site probably null
R2085:Malt1 UTSW 18 65473147 missense probably damaging 1.00
R2962:Malt1 UTSW 18 65448335 missense probably benign 0.01
R4193:Malt1 UTSW 18 65447675 missense probably benign 0.00
R4359:Malt1 UTSW 18 65476229 missense probably benign 0.00
R4913:Malt1 UTSW 18 65476280 missense probably damaging 1.00
R5201:Malt1 UTSW 18 65476055 missense probably benign
R5925:Malt1 UTSW 18 65431368 missense possibly damaging 0.86
R6944:Malt1 UTSW 18 65437920 missense probably benign 0.08
R7108:Malt1 UTSW 18 65464051 missense probably damaging 1.00
R7184:Malt1 UTSW 18 65447693 missense probably benign
R7192:Malt1 UTSW 18 65437827 missense probably benign 0.07
R7307:Malt1 UTSW 18 65451569 missense possibly damaging 0.48
R7308:Malt1 UTSW 18 65449609 critical splice donor site probably null
R7490:Malt1 UTSW 18 65448211 missense probably benign 0.04
R7756:Malt1 UTSW 18 65473119 missense probably benign 0.01
R7758:Malt1 UTSW 18 65473119 missense probably benign 0.01
R7892:Malt1 UTSW 18 65464116 critical splice donor site probably null
R7975:Malt1 UTSW 18 65464116 critical splice donor site probably null
Z1177:Malt1 UTSW 18 65431373 missense probably damaging 1.00
Z1177:Malt1 UTSW 18 65448284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGTGAGCATTTTCTGTCAG -3'
(R):5'- GTCACATGGACATGGACTCTAGAG -3'

Sequencing Primer
(F):5'- CCACTCCCAGGATTGTTATA -3'
(R):5'- GTTTCCAGAACCTCACAGTTCCTAGG -3'
Posted On2019-10-17