Incidental Mutation 'R7558:Slc22a26'
ID584914
Institutional Source Beutler Lab
Gene Symbol Slc22a26
Ensembl Gene ENSMUSG00000053303
Gene Namesolute carrier family 22 (organic cation transporter), member 26
SynonymsBC014805
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7781041-7802667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7785286 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 430 (M430L)
Ref Sequence ENSEMBL: ENSMUSP00000064809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065634] [ENSMUST00000120522]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065634
AA Change: M430L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064809
Gene: ENSMUSG00000053303
AA Change: M430L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 96 528 1.1e-23 PFAM
Pfam:MFS_1 124 370 7.8e-17 PFAM
Pfam:MFS_1 350 547 2.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120522
AA Change: M429L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113607
Gene: ENSMUSG00000053303
AA Change: M429L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 94 527 4.9e-23 PFAM
Pfam:MFS_1 124 358 1.2e-15 PFAM
Pfam:MFS_1 349 547 2.4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Slc22a26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a26 APN 19 7782836 missense probably damaging 0.99
IGL00338:Slc22a26 APN 19 7782975 missense probably benign 0.25
IGL00736:Slc22a26 APN 19 7790162 missense possibly damaging 0.50
IGL01085:Slc22a26 APN 19 7790099 missense probably benign 0.02
IGL01581:Slc22a26 APN 19 7802184 missense probably benign 0.15
IGL02502:Slc22a26 APN 19 7790760 critical splice donor site probably null
IGL02658:Slc22a26 APN 19 7788248 missense probably benign 0.25
IGL02936:Slc22a26 APN 19 7791105 missense probably damaging 0.99
IGL03162:Slc22a26 APN 19 7802101 missense probably benign 0.00
R0034:Slc22a26 UTSW 19 7802253 missense probably benign 0.03
R0633:Slc22a26 UTSW 19 7788210 critical splice donor site probably null
R0676:Slc22a26 UTSW 19 7796144 splice site probably benign
R2156:Slc22a26 UTSW 19 7802115 missense probably damaging 1.00
R4043:Slc22a26 UTSW 19 7788329 critical splice acceptor site probably null
R4781:Slc22a26 UTSW 19 7790135 missense probably benign 0.34
R4896:Slc22a26 UTSW 19 7791054 missense probably benign 0.14
R4999:Slc22a26 UTSW 19 7802181 missense probably damaging 1.00
R5125:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R5178:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R6161:Slc22a26 UTSW 19 7786447 missense possibly damaging 0.50
R6494:Slc22a26 UTSW 19 7802286 missense probably damaging 1.00
R6512:Slc22a26 UTSW 19 7802500 start gained probably benign
R6724:Slc22a26 UTSW 19 7802361 missense probably benign 0.14
R7323:Slc22a26 UTSW 19 7790894 missense probably damaging 0.97
R7375:Slc22a26 UTSW 19 7783144 intron probably null
R7634:Slc22a26 UTSW 19 7802587 utr 5 prime probably null
Predicted Primers PCR Primer
(F):5'- GCTCACAGCTCGAAATAATGC -3'
(R):5'- ATGCAGTGGCTCACAAGTATTG -3'

Sequencing Primer
(F):5'- CAGCTCGAAATAATGCATCTTGC -3'
(R):5'- AGTGGCTCACAAGTATTGATCCC -3'
Posted On2019-10-17