Incidental Mutation 'R7558:Trpm6'
ID584916
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7558 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18778665 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 91 (F91L)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: F91L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: F91L

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.5143 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lemd2 C A 17: 27,204,163 A86S probably benign Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18827408 missense probably benign 0.03
R7747:Trpm6 UTSW 19 18750045 splice site probably null
R7807:Trpm6 UTSW 19 18829856 missense probably benign 0.11
R7870:Trpm6 UTSW 19 18815241 missense probably benign 0.01
R7891:Trpm6 UTSW 19 18776710 missense probably benign 0.01
R7955:Trpm6 UTSW 19 18854290 missense probably benign 0.01
R7965:Trpm6 UTSW 19 18876110 missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18778659 missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18815350 missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18792862 missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18811790 missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18873861 missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18853968 missense probably benign 0.39
R8413:Trpm6 UTSW 19 18832485 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACCAATTGTTCTATTCTGAGTG -3'
(R):5'- TACCTGGGATGCAAGCATTG -3'

Sequencing Primer
(F):5'- CCAATTGTTCTATTCTGAGTGACTTG -3'
(R):5'- GCATTGCCTCTCATACCTAAGAG -3'
Posted On2019-10-17