Incidental Mutation 'R7558:Vax1'
ID584917
Institutional Source Beutler Lab
Gene Symbol Vax1
Ensembl Gene ENSMUSG00000006270
Gene Nameventral anterior homeobox 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R7558 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location59166187-59170056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59169984 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 16 (T16A)
Ref Sequence ENSEMBL: ENSMUSP00000134642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172821]
Predicted Effect unknown
Transcript: ENSMUST00000172821
AA Change: T16A
SMART Domains Protein: ENSMUSP00000134642
Gene: ENSMUSG00000006270
AA Change: T16A

DomainStartEndE-ValueType
HOX 100 162 1.34e-27 SMART
low complexity region 187 206 N/A INTRINSIC
low complexity region 208 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the EMX homeobox protein family. The encoded protein functions as a transcription factor which is important in the development of anterior ventral forebrain and visual system. Disruption of this gene causes impairment in the developing forebrain, where the encoded protein is necessary for axon guidance and major tract formation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants exhibit cleft palate and most die at birth. A few survive to 2 weeks of age. Mutants display defects in axon guidance, coloboma, dysgenesis of the optic nerve, defects of basal telencephalon, and holoprosencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Vax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4297:Vax1 UTSW 19 59166251 nonsense probably null
R5753:Vax1 UTSW 19 59166382 missense probably benign 0.13
R5897:Vax1 UTSW 19 59169801 missense unknown
R6063:Vax1 UTSW 19 59168604 missense unknown
R6378:Vax1 UTSW 19 59166224 missense probably benign 0.08
R6874:Vax1 UTSW 19 59168523 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGGATCCGGCGACAGTAATC -3'
(R):5'- ACTGGACGTGCTCAAAGGAC -3'

Sequencing Primer
(F):5'- ACAGTAATCTGGGTCCGCTGAG -3'
(R):5'- ACATTCATTCTGGCGGGC -3'
Posted On2019-10-17