Incidental Mutation 'R7559:Lamc3'
ID584922
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Namelaminin gamma 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7559 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location31887291-31946539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31922368 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 939 (K939R)
Ref Sequence ENSEMBL: ENSMUSP00000028187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
Predicted Effect probably benign
Transcript: ENSMUST00000028187
AA Change: K939R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: K939R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138325
AA Change: K939R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: K939R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,279,540 R206L probably damaging Het
Adcy3 A G 12: 4,198,440 K501E probably benign Het
Agl T C 3: 116,752,115 D679G Het
Ankrd10 A T 8: 11,612,548 V395D probably damaging Het
Ano5 A G 7: 51,574,888 I531V probably damaging Het
Apol9a T A 15: 77,404,561 H202L possibly damaging Het
Atp6v1c2 A C 12: 17,301,214 I105M probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Coro1b T C 19: 4,150,221 probably null Het
D930020B18Rik A G 10: 121,656,226 probably benign Het
Dcst2 T C 3: 89,368,714 F384S possibly damaging Het
Ddx39 T A 8: 83,720,966 F147I possibly damaging Het
Drosha A G 15: 12,842,422 E393G probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam20c G T 5: 138,793,199 E287D possibly damaging Het
Flnc T A 6: 29,459,010 D2463E probably damaging Het
Flt4 A T 11: 49,644,371 I1209F possibly damaging Het
Foxp1 T C 6: 98,945,560 D437G unknown Het
Fras1 T C 5: 96,740,854 V2753A possibly damaging Het
Ftsj3 T C 11: 106,252,987 D277G possibly damaging Het
Gad1 T C 2: 70,563,912 probably null Het
Gal3st2c A G 1: 94,009,353 Y340C probably damaging Het
Gbp9 A G 5: 105,085,109 F226L probably damaging Het
Gm11992 C T 11: 9,052,747 P37S possibly damaging Het
Gm19668 G T 10: 77,798,738 C132* probably null Het
Hdac3 A T 18: 37,945,516 F139I possibly damaging Het
Hectd4 A G 5: 121,315,510 probably null Het
Helz T A 11: 107,600,278 S162T possibly damaging Het
Hspb6 C A 7: 30,554,287 S75Y probably damaging Het
Il17rb T A 14: 29,997,043 I361F probably damaging Het
Iqsec3 A T 6: 121,387,780 V850D probably damaging Het
Knl1 A G 2: 119,094,006 E1840G possibly damaging Het
Lmo7 C T 14: 101,887,226 R496* probably null Het
Lsm14a A T 7: 34,353,401 C374* probably null Het
Luc7l T C 17: 26,255,115 L49P probably damaging Het
Mdga2 A C 12: 66,473,229 C988G probably damaging Het
Mtf1 T C 4: 124,820,206 V136A probably damaging Het
Myo7b T A 18: 31,983,360 I1016F probably benign Het
Nadsyn1 C A 7: 143,808,067 A306S probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nr4a1 T C 15: 101,270,899 V272A probably damaging Het
Olfr504 C T 7: 108,565,556 A80T probably damaging Het
Olfr538 T A 7: 140,574,443 C97S probably damaging Het
Olfr654 C A 7: 104,587,880 H25Q probably damaging Het
Opcml A T 9: 28,903,324 T291S probably benign Het
Osbp2 C G 11: 3,712,493 K196N probably damaging Het
Otoa T C 7: 121,143,926 V792A probably damaging Het
Pcmtd1 A G 1: 7,169,542 D245G probably damaging Het
Pcnx T C 12: 81,993,122 V1428A unknown Het
Pik3r4 A G 9: 105,678,153 H1103R probably benign Het
Pjvk C T 2: 76,655,810 H185Y probably benign Het
Pkd1l3 T C 8: 109,624,440 V639A probably benign Het
Pklr T C 3: 89,143,058 S405P probably damaging Het
Pla2g12a T A 3: 129,878,920 Y68N probably damaging Het
Proz A G 8: 13,063,455 H92R probably benign Het
Sec23ip G T 7: 128,777,350 V844F possibly damaging Het
Sema3f A G 9: 107,684,578 V520A possibly damaging Het
Serpinb12 A G 1: 106,953,723 I197V probably damaging Het
Sim2 A T 16: 94,109,359 I207F possibly damaging Het
Slc15a2 C T 16: 36,751,897 V702I probably benign Het
Slc35f4 T C 14: 49,304,275 I341V probably benign Het
Spam1 A G 6: 24,800,453 Y397C probably damaging Het
Spire1 A T 18: 67,501,117 M417K probably benign Het
Srcap T C 7: 127,530,550 S515P unknown Het
Tfrc T A 16: 32,621,417 probably null Het
Topors A G 4: 40,261,401 S628P unknown Het
Trim71 T C 9: 114,513,042 Y724C probably damaging Het
Ttn C T 2: 76,792,855 V15413I probably damaging Het
Vmn1r21 A T 6: 57,844,242 N72K probably damaging Het
Vmn2r80 A T 10: 79,194,625 M762L probably benign Het
Wdr62 A G 7: 30,270,773 I203T probably damaging Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31900581 missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31918521 missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31914656 missense probably benign 0.07
IGL01086:Lamc3 APN 2 31898476 missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31912107 missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31898278 missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31887655 missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31914604 splice site probably benign
IGL02340:Lamc3 APN 2 31918457 missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31905965 missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31920662 missense probably benign 0.00
IGL02679:Lamc3 APN 2 31945398 missense probably benign 0.01
IGL02751:Lamc3 APN 2 31920704 missense probably benign 0.07
IGL02820:Lamc3 APN 2 31923022 missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31935725 splice site probably benign
IGL02926:Lamc3 APN 2 31935726 splice site probably benign
IGL03090:Lamc3 APN 2 31908698 splice site probably benign
IGL03258:Lamc3 APN 2 31887683 missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31922428 missense probably benign 0.07
R0137:Lamc3 UTSW 2 31908616 missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31915084 splice site probably benign
R0244:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R0512:Lamc3 UTSW 2 31937968 missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31928802 missense probably benign 0.03
R1142:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31928847 missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31887411 missense probably benign
R1515:Lamc3 UTSW 2 31940751 missense probably damaging 1.00
R1642:Lamc3 UTSW 2 31915996 missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31921781 missense probably null 0.01
R1707:Lamc3 UTSW 2 31912129 critical splice donor site probably null
R1714:Lamc3 UTSW 2 31940757 missense probably benign 0.02
R1838:Lamc3 UTSW 2 31925582 missense possibly damaging 0.89
R2940:Lamc3 UTSW 2 31940702 missense probably benign 0.02
R3177:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31924592 missense probably benign 0.01
R4065:Lamc3 UTSW 2 31945258 missense probably benign 0.00
R4089:Lamc3 UTSW 2 31920508 nonsense probably null
R4373:Lamc3 UTSW 2 31898232 missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31931952 missense probably benign
R4395:Lamc3 UTSW 2 31931952 missense probably benign
R4397:Lamc3 UTSW 2 31931952 missense probably benign
R4746:Lamc3 UTSW 2 31905614 missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31940736 missense probably benign 0.02
R4960:Lamc3 UTSW 2 31915954 missense probably benign 0.00
R5025:Lamc3 UTSW 2 31908669 missense probably benign 0.13
R5062:Lamc3 UTSW 2 31905667 missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31887344 start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31918596 missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31931985 missense probably benign
R5655:Lamc3 UTSW 2 31925717 missense probably benign 0.01
R5928:Lamc3 UTSW 2 31921709 missense probably benign 0.00
R6018:Lamc3 UTSW 2 31905712 missense probably damaging 1.00
R6479:Lamc3 UTSW 2 31887401 missense probably benign
R6601:Lamc3 UTSW 2 31920532 missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31908689 missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31938069 missense probably benign
R7114:Lamc3 UTSW 2 31930645 missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31930702 missense probably benign 0.39
R7787:Lamc3 UTSW 2 31900539 missense probably damaging 0.99
R7819:Lamc3 UTSW 2 31921763 missense probably benign
X0010:Lamc3 UTSW 2 31938012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCTTGGAGCCTTCAATG -3'
(R):5'- TCTTGTAGGTCATCTCCAGCAAG -3'

Sequencing Primer
(F):5'- AGTTCATAGTGACTTACCAGATCTG -3'
(R):5'- GTAGGTCATCTCCAGCAAGAGACC -3'
Posted On2019-10-17