Incidental Mutation 'R7559:Foxp1'
ID584942
Institutional Source Beutler Lab
Gene Symbol Foxp1
Ensembl Gene ENSMUSG00000030067
Gene Nameforkhead box P1
Synonyms4932443N09Rik, 3110052D19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7559 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location98925338-99522721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98945560 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 437 (D437G)
Ref Sequence ENSEMBL: ENSMUSP00000108952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074346] [ENSMUST00000113322] [ENSMUST00000113324] [ENSMUST00000113326] [ENSMUST00000113328] [ENSMUST00000113329] [ENSMUST00000124058] [ENSMUST00000176565] [ENSMUST00000176632] [ENSMUST00000176850] [ENSMUST00000177229] [ENSMUST00000177230] [ENSMUST00000177307] [ENSMUST00000177437]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074346
AA Change: D469G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073953
Gene: ENSMUSG00000030067
AA Change: D469G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113322
AA Change: D469G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108948
Gene: ENSMUSG00000030067
AA Change: D469G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113324
AA Change: D470G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108950
Gene: ENSMUSG00000030067
AA Change: D470G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113326
AA Change: D437G
SMART Domains Protein: ENSMUSP00000108952
Gene: ENSMUSG00000030067
AA Change: D437G

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 201 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 285 298 N/A INTRINSIC
ZnF_C2H2 302 327 8.67e-1 SMART
low complexity region 339 351 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
FH 459 540 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113328
AA Change: D470G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108954
Gene: ENSMUSG00000030067
AA Change: D470G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113329
AA Change: D469G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108955
Gene: ENSMUSG00000030067
AA Change: D469G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 579 1.76e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124058
AA Change: D340G

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120244
Gene: ENSMUSG00000030067
AA Change: D340G

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
ZnF_C2H2 205 230 8.67e-1 SMART
low complexity region 242 254 N/A INTRINSIC
low complexity region 303 317 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176565
AA Change: D470G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135181
Gene: ENSMUSG00000030067
AA Change: D470G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176632
AA Change: D438G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135635
Gene: ENSMUSG00000030067
AA Change: D438G

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 202 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
ZnF_C2H2 303 328 8.67e-1 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 401 415 N/A INTRINSIC
FH 460 541 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176850
AA Change: D439G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135041
Gene: ENSMUSG00000030067
AA Change: D439G

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177229
AA Change: D341G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134817
Gene: ENSMUSG00000030067
AA Change: D341G

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 105 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
ZnF_C2H2 206 231 8.67e-1 SMART
low complexity region 243 255 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
FH 363 444 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177230
AA Change: D439G

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135098
Gene: ENSMUSG00000030067
AA Change: D439G

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177307
AA Change: D471G
SMART Domains Protein: ENSMUSP00000135764
Gene: ENSMUSG00000030067
AA Change: D471G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
ZnF_C2H2 336 361 8.67e-1 SMART
low complexity region 373 385 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177437
AA Change: D340G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135809
Gene: ENSMUSG00000030067
AA Change: D340G

DomainStartEndE-ValueType
low complexity region 10 61 N/A INTRINSIC
low complexity region 70 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
ZnF_C2H2 205 230 8.67e-1 SMART
low complexity region 242 254 N/A INTRINSIC
low complexity region 303 317 N/A INTRINSIC
FH 362 443 2.07e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal outflow tract septation, ventricular septal defects, abnormal cardiac valve morphology, decreased and irregular heart rate, thin ventricular compact zone, and edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,279,540 R206L probably damaging Het
Adcy3 A G 12: 4,198,440 K501E probably benign Het
Agl T C 3: 116,752,115 D679G Het
Ankrd10 A T 8: 11,612,548 V395D probably damaging Het
Ano5 A G 7: 51,574,888 I531V probably damaging Het
Apol9a T A 15: 77,404,561 H202L possibly damaging Het
Atp6v1c2 A C 12: 17,301,214 I105M probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Coro1b T C 19: 4,150,221 probably null Het
Dcst2 T C 3: 89,368,714 F384S possibly damaging Het
Ddx39 T A 8: 83,720,966 F147I possibly damaging Het
Drosha A G 15: 12,842,422 E393G probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam20c G T 5: 138,793,199 E287D possibly damaging Het
Flnc T A 6: 29,459,010 D2463E probably damaging Het
Flt4 A T 11: 49,644,371 I1209F possibly damaging Het
Fras1 T C 5: 96,740,854 V2753A possibly damaging Het
Ftsj3 T C 11: 106,252,987 D277G possibly damaging Het
Gad1 T C 2: 70,563,912 probably null Het
Gal3st2c A G 1: 94,009,353 Y340C probably damaging Het
Gbp9 A G 5: 105,085,109 F226L probably damaging Het
Gm11992 C T 11: 9,052,747 P37S possibly damaging Het
Gm19668 G T 10: 77,798,738 C132* probably null Het
Hdac3 A T 18: 37,945,516 F139I possibly damaging Het
Hectd4 A G 5: 121,315,510 probably null Het
Helz T A 11: 107,600,278 S162T possibly damaging Het
Hspb6 C A 7: 30,554,287 S75Y probably damaging Het
Il17rb T A 14: 29,997,043 I361F probably damaging Het
Iqsec3 A T 6: 121,387,780 V850D probably damaging Het
Knl1 A G 2: 119,094,006 E1840G possibly damaging Het
Lamc3 A G 2: 31,922,368 K939R probably benign Het
Lmo7 C T 14: 101,887,226 R496* probably null Het
Lsm14a A T 7: 34,353,401 C374* probably null Het
Luc7l T C 17: 26,255,115 L49P probably damaging Het
Mdga2 A C 12: 66,473,229 C988G probably damaging Het
Mtf1 T C 4: 124,820,206 V136A probably damaging Het
Myo7b T A 18: 31,983,360 I1016F probably benign Het
Nadsyn1 C A 7: 143,808,067 A306S probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nr4a1 T C 15: 101,270,899 V272A probably damaging Het
Olfr504 C T 7: 108,565,556 A80T probably damaging Het
Olfr538 T A 7: 140,574,443 C97S probably damaging Het
Olfr654 C A 7: 104,587,880 H25Q probably damaging Het
Opcml A T 9: 28,903,324 T291S probably benign Het
Osbp2 C G 11: 3,712,493 K196N probably damaging Het
Otoa T C 7: 121,143,926 V792A probably damaging Het
Pcmtd1 A G 1: 7,169,542 D245G probably damaging Het
Pcnx T C 12: 81,993,122 V1428A unknown Het
Pik3r4 A G 9: 105,678,153 H1103R probably benign Het
Pjvk C T 2: 76,655,810 H185Y probably benign Het
Pkd1l3 T C 8: 109,624,440 V639A probably benign Het
Pklr T C 3: 89,143,058 S405P probably damaging Het
Pla2g12a T A 3: 129,878,920 Y68N probably damaging Het
Sec23ip G T 7: 128,777,350 V844F possibly damaging Het
Sema3f A G 9: 107,684,578 V520A possibly damaging Het
Serpinb12 A G 1: 106,953,723 I197V probably damaging Het
Sim2 A T 16: 94,109,359 I207F possibly damaging Het
Slc15a2 C T 16: 36,751,897 V702I probably benign Het
Slc35f4 T C 14: 49,304,275 I341V probably benign Het
Spam1 A G 6: 24,800,453 Y397C probably damaging Het
Spire1 A T 18: 67,501,117 M417K probably benign Het
Srcap T C 7: 127,530,550 S515P unknown Het
Tfrc T A 16: 32,621,417 probably null Het
Topors A G 4: 40,261,401 S628P unknown Het
Trim71 T C 9: 114,513,042 Y724C probably damaging Het
Ttn C T 2: 76,792,855 V15413I probably damaging Het
Vmn1r21 A T 6: 57,844,242 N72K probably damaging Het
Vmn2r80 A T 10: 79,194,625 M762L probably benign Het
Wdr62 A G 7: 30,270,773 I203T probably damaging Het
Other mutations in Foxp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Foxp1 APN 6 98945600 missense probably damaging 0.99
IGL02330:Foxp1 APN 6 98945412 missense probably damaging 1.00
IGL02869:Foxp1 APN 6 98930083 utr 3 prime probably benign
IGL02968:Foxp1 APN 6 99075861 missense probably damaging 1.00
Foxy UTSW 6 99015510 nonsense probably null
Moxie UTSW 6 99015514 critical splice acceptor site probably null
R0037:Foxp1 UTSW 6 99162969 missense probably damaging 1.00
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0427:Foxp1 UTSW 6 98930203 missense probably damaging 1.00
R0601:Foxp1 UTSW 6 98930122 missense probably damaging 1.00
R1356:Foxp1 UTSW 6 99016676 splice site probably benign
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1548:Foxp1 UTSW 6 98945420 missense probably damaging 1.00
R1696:Foxp1 UTSW 6 98945702 missense probably benign 0.18
R1933:Foxp1 UTSW 6 99075965 small deletion probably benign
R2152:Foxp1 UTSW 6 99016541 missense probably damaging 0.99
R2338:Foxp1 UTSW 6 99003293 missense possibly damaging 0.61
R3896:Foxp1 UTSW 6 99075936 missense probably benign 0.33
R5006:Foxp1 UTSW 6 99162858 missense probably damaging 0.98
R5143:Foxp1 UTSW 6 98945532 critical splice donor site probably null
R5428:Foxp1 UTSW 6 99016631 missense probably damaging 1.00
R5765:Foxp1 UTSW 6 99015462 missense probably damaging 0.99
R5816:Foxp1 UTSW 6 99075965 small deletion probably benign
R6172:Foxp1 UTSW 6 99015510 nonsense probably null
R6172:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6173:Foxp1 UTSW 6 99015510 nonsense probably null
R6173:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6175:Foxp1 UTSW 6 98966076 missense probably damaging 1.00
R6776:Foxp1 UTSW 6 99075965 small deletion probably benign
R6782:Foxp1 UTSW 6 98930145 missense probably damaging 1.00
R7229:Foxp1 UTSW 6 98935412 missense unknown
R7715:Foxp1 UTSW 6 98945660 missense unknown
X0066:Foxp1 UTSW 6 99076015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTACCTGCCTGATTAAAGATGC -3'
(R):5'- TCTCCTCACAGCTGAATCTGG -3'

Sequencing Primer
(F):5'- AAATGGTGGTCTAACTTCCGC -3'
(R):5'- GCTGAATCTGGTATCAAGTGTCACC -3'
Posted On2019-10-17