Incidental Mutation 'R7559:Olfr538'
ID584953
Institutional Source Beutler Lab
Gene Symbol Olfr538
Ensembl Gene ENSMUSG00000095901
Gene Nameolfactory receptor 538
SynonymsMOR253-13P, MOR253-13P, GA_x6K02T2PBJ9-42723314-42724246, MOR253-10P, Olfr1553-ps1, MOR253-12P, Olfr1523-ps1, MOR253-12P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R7559 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140567886-140575793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140574443 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 97 (C97S)
Ref Sequence ENSEMBL: ENSMUSP00000147315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084457] [ENSMUST00000210973]
Predicted Effect probably damaging
Transcript: ENSMUST00000084457
AA Change: C97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081495
Gene: ENSMUSG00000095901
AA Change: C97S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.8e-6 PFAM
Pfam:7tm_1 41 290 2.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210973
AA Change: C97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,279,540 R206L probably damaging Het
Adcy3 A G 12: 4,198,440 K501E probably benign Het
Agl T C 3: 116,752,115 D679G Het
Ankrd10 A T 8: 11,612,548 V395D probably damaging Het
Ano5 A G 7: 51,574,888 I531V probably damaging Het
Apol9a T A 15: 77,404,561 H202L possibly damaging Het
Atp6v1c2 A C 12: 17,301,214 I105M probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Coro1b T C 19: 4,150,221 probably null Het
D930020B18Rik A G 10: 121,656,226 probably benign Het
Dcst2 T C 3: 89,368,714 F384S possibly damaging Het
Ddx39 T A 8: 83,720,966 F147I possibly damaging Het
Drosha A G 15: 12,842,422 E393G probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam20c G T 5: 138,793,199 E287D possibly damaging Het
Flnc T A 6: 29,459,010 D2463E probably damaging Het
Flt4 A T 11: 49,644,371 I1209F possibly damaging Het
Foxp1 T C 6: 98,945,560 D437G unknown Het
Fras1 T C 5: 96,740,854 V2753A possibly damaging Het
Ftsj3 T C 11: 106,252,987 D277G possibly damaging Het
Gad1 T C 2: 70,563,912 probably null Het
Gal3st2c A G 1: 94,009,353 Y340C probably damaging Het
Gbp9 A G 5: 105,085,109 F226L probably damaging Het
Gm11992 C T 11: 9,052,747 P37S possibly damaging Het
Gm19668 G T 10: 77,798,738 C132* probably null Het
Hdac3 A T 18: 37,945,516 F139I possibly damaging Het
Hectd4 A G 5: 121,315,510 probably null Het
Helz T A 11: 107,600,278 S162T possibly damaging Het
Hspb6 C A 7: 30,554,287 S75Y probably damaging Het
Il17rb T A 14: 29,997,043 I361F probably damaging Het
Iqsec3 A T 6: 121,387,780 V850D probably damaging Het
Knl1 A G 2: 119,094,006 E1840G possibly damaging Het
Lamc3 A G 2: 31,922,368 K939R probably benign Het
Lmo7 C T 14: 101,887,226 R496* probably null Het
Lsm14a A T 7: 34,353,401 C374* probably null Het
Luc7l T C 17: 26,255,115 L49P probably damaging Het
Mdga2 A C 12: 66,473,229 C988G probably damaging Het
Mtf1 T C 4: 124,820,206 V136A probably damaging Het
Myo7b T A 18: 31,983,360 I1016F probably benign Het
Nadsyn1 C A 7: 143,808,067 A306S probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nr4a1 T C 15: 101,270,899 V272A probably damaging Het
Olfr504 C T 7: 108,565,556 A80T probably damaging Het
Olfr654 C A 7: 104,587,880 H25Q probably damaging Het
Opcml A T 9: 28,903,324 T291S probably benign Het
Osbp2 C G 11: 3,712,493 K196N probably damaging Het
Otoa T C 7: 121,143,926 V792A probably damaging Het
Pcmtd1 A G 1: 7,169,542 D245G probably damaging Het
Pcnx T C 12: 81,993,122 V1428A unknown Het
Pik3r4 A G 9: 105,678,153 H1103R probably benign Het
Pjvk C T 2: 76,655,810 H185Y probably benign Het
Pkd1l3 T C 8: 109,624,440 V639A probably benign Het
Pklr T C 3: 89,143,058 S405P probably damaging Het
Pla2g12a T A 3: 129,878,920 Y68N probably damaging Het
Proz A G 8: 13,063,455 H92R probably benign Het
Sec23ip G T 7: 128,777,350 V844F possibly damaging Het
Sema3f A G 9: 107,684,578 V520A possibly damaging Het
Serpinb12 A G 1: 106,953,723 I197V probably damaging Het
Sim2 A T 16: 94,109,359 I207F possibly damaging Het
Slc15a2 C T 16: 36,751,897 V702I probably benign Het
Slc35f4 T C 14: 49,304,275 I341V probably benign Het
Spam1 A G 6: 24,800,453 Y397C probably damaging Het
Spire1 A T 18: 67,501,117 M417K probably benign Het
Srcap T C 7: 127,530,550 S515P unknown Het
Tfrc T A 16: 32,621,417 probably null Het
Topors A G 4: 40,261,401 S628P unknown Het
Trim71 T C 9: 114,513,042 Y724C probably damaging Het
Ttn C T 2: 76,792,855 V15413I probably damaging Het
Vmn1r21 A T 6: 57,844,242 N72K probably damaging Het
Vmn2r80 A T 10: 79,194,625 M762L probably benign Het
Wdr62 A G 7: 30,270,773 I203T probably damaging Het
Other mutations in Olfr538
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Olfr538 APN 7 140574770 missense possibly damaging 0.93
IGL02066:Olfr538 APN 7 140574500 missense possibly damaging 0.55
IGL02214:Olfr538 APN 7 140574557 nonsense probably null
IGL02466:Olfr538 APN 7 140574771 missense probably benign 0.01
IGL02534:Olfr538 APN 7 140574641 missense probably benign 0.00
R0631:Olfr538 UTSW 7 140574507 missense probably damaging 1.00
R0989:Olfr538 UTSW 7 140574287 missense probably damaging 0.99
R1470:Olfr538 UTSW 7 140574749 missense probably benign 0.02
R1470:Olfr538 UTSW 7 140574749 missense probably benign 0.02
R1533:Olfr538 UTSW 7 140575121 unclassified probably null
R1764:Olfr538 UTSW 7 140574470 missense probably damaging 0.97
R2184:Olfr538 UTSW 7 140574402 missense probably benign
R2513:Olfr538 UTSW 7 140574156 start codon destroyed probably null 0.97
R4445:Olfr538 UTSW 7 140574389 missense probably damaging 1.00
R4476:Olfr538 UTSW 7 140574929 missense probably damaging 1.00
R4607:Olfr538 UTSW 7 140574641 missense probably benign 0.02
R4608:Olfr538 UTSW 7 140574641 missense probably benign 0.02
R4752:Olfr538 UTSW 7 140574602 missense possibly damaging 0.57
R6934:Olfr538 UTSW 7 140574651 missense probably damaging 1.00
R6978:Olfr538 UTSW 7 140574287 missense probably damaging 0.99
R7583:Olfr538 UTSW 7 140574210 missense probably benign 0.01
R7685:Olfr538 UTSW 7 140574246 missense probably damaging 1.00
Z1177:Olfr538 UTSW 7 140574956 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCCTGTCCCTGTACACAGTG -3'
(R):5'- GTCATCAGGCCAGTGTGTAC -3'

Sequencing Primer
(F):5'- CCCTGTACACAGTGGCTTTAATGG -3'
(R):5'- GCCAGTGTGTACAGATGCATTCAC -3'
Posted On2019-10-17