Incidental Mutation 'R7559:Opcml'
ID584958
Institutional Source Beutler Lab
Gene Symbol Opcml
Ensembl Gene ENSMUSG00000062257
Gene Nameopioid binding protein/cell adhesion molecule-like
SynonymsObcam, B930023M13Rik, 2900075O15Rik, LOC235104
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7559 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location27790775-28925410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28903324 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 291 (T291S)
Ref Sequence ENSEMBL: ENSMUSP00000110898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073822] [ENSMUST00000115243]
Predicted Effect probably benign
Transcript: ENSMUST00000073822
AA Change: T299S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000073493
Gene: ENSMUSG00000062257
AA Change: T299S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 42 133 2.94e-10 SMART
IGc2 148 209 2.91e-14 SMART
IGc2 235 303 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115243
AA Change: T291S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110898
Gene: ENSMUSG00000062257
AA Change: T291S

DomainStartEndE-ValueType
IG 35 126 2.94e-10 SMART
IGc2 141 201 1.36e-14 SMART
IGc2 227 295 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,279,540 R206L probably damaging Het
Adcy3 A G 12: 4,198,440 K501E probably benign Het
Agl T C 3: 116,752,115 D679G Het
Ankrd10 A T 8: 11,612,548 V395D probably damaging Het
Ano5 A G 7: 51,574,888 I531V probably damaging Het
Apol9a T A 15: 77,404,561 H202L possibly damaging Het
Atp6v1c2 A C 12: 17,301,214 I105M probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Coro1b T C 19: 4,150,221 probably null Het
D930020B18Rik A G 10: 121,656,226 probably benign Het
Dcst2 T C 3: 89,368,714 F384S possibly damaging Het
Ddx39 T A 8: 83,720,966 F147I possibly damaging Het
Drosha A G 15: 12,842,422 E393G probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam20c G T 5: 138,793,199 E287D possibly damaging Het
Flnc T A 6: 29,459,010 D2463E probably damaging Het
Flt4 A T 11: 49,644,371 I1209F possibly damaging Het
Foxp1 T C 6: 98,945,560 D437G unknown Het
Fras1 T C 5: 96,740,854 V2753A possibly damaging Het
Ftsj3 T C 11: 106,252,987 D277G possibly damaging Het
Gad1 T C 2: 70,563,912 probably null Het
Gal3st2c A G 1: 94,009,353 Y340C probably damaging Het
Gbp9 A G 5: 105,085,109 F226L probably damaging Het
Gm11992 C T 11: 9,052,747 P37S possibly damaging Het
Gm19668 G T 10: 77,798,738 C132* probably null Het
Hdac3 A T 18: 37,945,516 F139I possibly damaging Het
Hectd4 A G 5: 121,315,510 probably null Het
Helz T A 11: 107,600,278 S162T possibly damaging Het
Hspb6 C A 7: 30,554,287 S75Y probably damaging Het
Il17rb T A 14: 29,997,043 I361F probably damaging Het
Iqsec3 A T 6: 121,387,780 V850D probably damaging Het
Knl1 A G 2: 119,094,006 E1840G possibly damaging Het
Lamc3 A G 2: 31,922,368 K939R probably benign Het
Lmo7 C T 14: 101,887,226 R496* probably null Het
Lsm14a A T 7: 34,353,401 C374* probably null Het
Luc7l T C 17: 26,255,115 L49P probably damaging Het
Mdga2 A C 12: 66,473,229 C988G probably damaging Het
Mtf1 T C 4: 124,820,206 V136A probably damaging Het
Myo7b T A 18: 31,983,360 I1016F probably benign Het
Nadsyn1 C A 7: 143,808,067 A306S probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nr4a1 T C 15: 101,270,899 V272A probably damaging Het
Olfr504 C T 7: 108,565,556 A80T probably damaging Het
Olfr538 T A 7: 140,574,443 C97S probably damaging Het
Olfr654 C A 7: 104,587,880 H25Q probably damaging Het
Osbp2 C G 11: 3,712,493 K196N probably damaging Het
Otoa T C 7: 121,143,926 V792A probably damaging Het
Pcmtd1 A G 1: 7,169,542 D245G probably damaging Het
Pcnx T C 12: 81,993,122 V1428A unknown Het
Pik3r4 A G 9: 105,678,153 H1103R probably benign Het
Pjvk C T 2: 76,655,810 H185Y probably benign Het
Pkd1l3 T C 8: 109,624,440 V639A probably benign Het
Pklr T C 3: 89,143,058 S405P probably damaging Het
Pla2g12a T A 3: 129,878,920 Y68N probably damaging Het
Proz A G 8: 13,063,455 H92R probably benign Het
Sec23ip G T 7: 128,777,350 V844F possibly damaging Het
Sema3f A G 9: 107,684,578 V520A possibly damaging Het
Serpinb12 A G 1: 106,953,723 I197V probably damaging Het
Sim2 A T 16: 94,109,359 I207F possibly damaging Het
Slc15a2 C T 16: 36,751,897 V702I probably benign Het
Slc35f4 T C 14: 49,304,275 I341V probably benign Het
Spam1 A G 6: 24,800,453 Y397C probably damaging Het
Spire1 A T 18: 67,501,117 M417K probably benign Het
Srcap T C 7: 127,530,550 S515P unknown Het
Tfrc T A 16: 32,621,417 probably null Het
Topors A G 4: 40,261,401 S628P unknown Het
Trim71 T C 9: 114,513,042 Y724C probably damaging Het
Ttn C T 2: 76,792,855 V15413I probably damaging Het
Vmn1r21 A T 6: 57,844,242 N72K probably damaging Het
Vmn2r80 A T 10: 79,194,625 M762L probably benign Het
Wdr62 A G 7: 30,270,773 I203T probably damaging Het
Other mutations in Opcml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Opcml APN 9 28901590 missense probably damaging 1.00
IGL00864:Opcml APN 9 28901591 missense probably damaging 1.00
IGL00956:Opcml APN 9 28675328 missense possibly damaging 0.86
IGL02391:Opcml APN 9 28675264 missense probably damaging 0.96
IGL03210:Opcml APN 9 28901537 missense probably damaging 0.99
R0373:Opcml UTSW 9 28813398 missense possibly damaging 0.48
R1037:Opcml UTSW 9 28903299 missense probably damaging 1.00
R1564:Opcml UTSW 9 28903316 missense probably damaging 1.00
R2094:Opcml UTSW 9 28901590 missense probably damaging 1.00
R2268:Opcml UTSW 9 28903355 missense possibly damaging 0.91
R2426:Opcml UTSW 9 28903367 critical splice donor site probably null
R2938:Opcml UTSW 9 27791386 start codon destroyed probably null 0.00
R3746:Opcml UTSW 9 28901530 missense possibly damaging 0.54
R4058:Opcml UTSW 9 28901588 missense probably damaging 1.00
R4173:Opcml UTSW 9 28903358 missense probably benign
R4882:Opcml UTSW 9 28901590 missense probably damaging 1.00
R5335:Opcml UTSW 9 28675325 missense possibly damaging 0.88
R7058:Opcml UTSW 9 28675211 nonsense probably null
R8050:Opcml UTSW 9 28813344 missense probably damaging 0.97
R8250:Opcml UTSW 9 28675270 missense probably damaging 1.00
Z1177:Opcml UTSW 9 28404377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCCTTTGAGTGCCTGCTG -3'
(R):5'- ACCTTGGACACATGACTGC -3'

Sequencing Primer
(F):5'- GAGTGCCTGCTGCTTCTCTTG -3'
(R):5'- GCCAGGAGGAGGATCTTAGC -3'
Posted On2019-10-17