Incidental Mutation 'R7559:Spire1'
ID584986
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Namespire type actin nucleation factor 1
Synonyms6030430B19Rik, Spir-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R7559 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location67488209-67610790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67501117 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 417 (M417K)
Ref Sequence ENSEMBL: ENSMUSP00000049336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
Predicted Effect probably benign
Transcript: ENSMUST00000045105
AA Change: M417K

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: M417K

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082243
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115050
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000224799
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,279,540 R206L probably damaging Het
Adcy3 A G 12: 4,198,440 K501E probably benign Het
Agl T C 3: 116,752,115 D679G Het
Ankrd10 A T 8: 11,612,548 V395D probably damaging Het
Ano5 A G 7: 51,574,888 I531V probably damaging Het
Apol9a T A 15: 77,404,561 H202L possibly damaging Het
Atp6v1c2 A C 12: 17,301,214 I105M probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Coro1b T C 19: 4,150,221 probably null Het
Dcst2 T C 3: 89,368,714 F384S possibly damaging Het
Ddx39 T A 8: 83,720,966 F147I possibly damaging Het
Drosha A G 15: 12,842,422 E393G probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam20c G T 5: 138,793,199 E287D possibly damaging Het
Flnc T A 6: 29,459,010 D2463E probably damaging Het
Flt4 A T 11: 49,644,371 I1209F possibly damaging Het
Foxp1 T C 6: 98,945,560 D437G unknown Het
Fras1 T C 5: 96,740,854 V2753A possibly damaging Het
Ftsj3 T C 11: 106,252,987 D277G possibly damaging Het
Gad1 T C 2: 70,563,912 probably null Het
Gal3st2c A G 1: 94,009,353 Y340C probably damaging Het
Gbp9 A G 5: 105,085,109 F226L probably damaging Het
Gm11992 C T 11: 9,052,747 P37S possibly damaging Het
Gm19668 G T 10: 77,798,738 C132* probably null Het
Hdac3 A T 18: 37,945,516 F139I possibly damaging Het
Hectd4 A G 5: 121,315,510 probably null Het
Helz T A 11: 107,600,278 S162T possibly damaging Het
Hspb6 C A 7: 30,554,287 S75Y probably damaging Het
Il17rb T A 14: 29,997,043 I361F probably damaging Het
Iqsec3 A T 6: 121,387,780 V850D probably damaging Het
Knl1 A G 2: 119,094,006 E1840G possibly damaging Het
Lamc3 A G 2: 31,922,368 K939R probably benign Het
Lmo7 C T 14: 101,887,226 R496* probably null Het
Lsm14a A T 7: 34,353,401 C374* probably null Het
Luc7l T C 17: 26,255,115 L49P probably damaging Het
Mdga2 A C 12: 66,473,229 C988G probably damaging Het
Mtf1 T C 4: 124,820,206 V136A probably damaging Het
Myo7b T A 18: 31,983,360 I1016F probably benign Het
Nadsyn1 C A 7: 143,808,067 A306S probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nr4a1 T C 15: 101,270,899 V272A probably damaging Het
Olfr504 C T 7: 108,565,556 A80T probably damaging Het
Olfr538 T A 7: 140,574,443 C97S probably damaging Het
Olfr654 C A 7: 104,587,880 H25Q probably damaging Het
Opcml A T 9: 28,903,324 T291S probably benign Het
Osbp2 C G 11: 3,712,493 K196N probably damaging Het
Otoa T C 7: 121,143,926 V792A probably damaging Het
Pcmtd1 A G 1: 7,169,542 D245G probably damaging Het
Pcnx T C 12: 81,993,122 V1428A unknown Het
Pik3r4 A G 9: 105,678,153 H1103R probably benign Het
Pjvk C T 2: 76,655,810 H185Y probably benign Het
Pkd1l3 T C 8: 109,624,440 V639A probably benign Het
Pklr T C 3: 89,143,058 S405P probably damaging Het
Pla2g12a T A 3: 129,878,920 Y68N probably damaging Het
Sec23ip G T 7: 128,777,350 V844F possibly damaging Het
Sema3f A G 9: 107,684,578 V520A possibly damaging Het
Serpinb12 A G 1: 106,953,723 I197V probably damaging Het
Sim2 A T 16: 94,109,359 I207F possibly damaging Het
Slc15a2 C T 16: 36,751,897 V702I probably benign Het
Slc35f4 T C 14: 49,304,275 I341V probably benign Het
Spam1 A G 6: 24,800,453 Y397C probably damaging Het
Srcap T C 7: 127,530,550 S515P unknown Het
Tfrc T A 16: 32,621,417 probably null Het
Topors A G 4: 40,261,401 S628P unknown Het
Trim71 T C 9: 114,513,042 Y724C probably damaging Het
Ttn C T 2: 76,792,855 V15413I probably damaging Het
Vmn1r21 A T 6: 57,844,242 N72K probably damaging Het
Vmn2r80 A T 10: 79,194,625 M762L probably benign Het
Wdr62 A G 7: 30,270,773 I203T probably damaging Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67529015 missense probably damaging 1.00
IGL01639:Spire1 APN 18 67545668 missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67506655 missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67491365 missense probably damaging 1.00
R0457:Spire1 UTSW 18 67552600 missense probably damaging 0.98
R0531:Spire1 UTSW 18 67491305 missense probably damaging 1.00
R0608:Spire1 UTSW 18 67528875 missense probably damaging 0.99
R2098:Spire1 UTSW 18 67503466 missense probably damaging 0.99
R2299:Spire1 UTSW 18 67530423 missense probably damaging 1.00
R3028:Spire1 UTSW 18 67491347 missense probably damaging 1.00
R3815:Spire1 UTSW 18 67506663 missense probably benign 0.05
R4049:Spire1 UTSW 18 67529031 splice site probably null
R4050:Spire1 UTSW 18 67529031 splice site probably null
R4059:Spire1 UTSW 18 67545713 missense probably damaging 0.98
R4109:Spire1 UTSW 18 67497217 missense probably damaging 1.00
R4700:Spire1 UTSW 18 67512865 missense probably benign 0.01
R4941:Spire1 UTSW 18 67519314 missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67552779 unclassified probably null
R5363:Spire1 UTSW 18 67506555 missense probably damaging 1.00
R5561:Spire1 UTSW 18 67506646 missense probably damaging 0.96
R5795:Spire1 UTSW 18 67495195 missense probably benign
R5952:Spire1 UTSW 18 67506709 missense probably benign 0.00
R5982:Spire1 UTSW 18 67497316 critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67519880 missense probably damaging 1.00
T0970:Spire1 UTSW 18 67501063 splice site probably null
Z1088:Spire1 UTSW 18 67495152 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTCTCCATTGAGATCACAGCATG -3'
(R):5'- TTGCAGGTCACTTGTTCAGC -3'

Sequencing Primer
(F):5'- GCGTCCTATACAAGATTGGAATCAGC -3'
(R):5'- GCAGGTCACTTGTTCAGCATTTTC -3'
Posted On2019-10-17