Incidental Mutation 'R7560:Nsun4'
ID585009
Institutional Source Beutler Lab
Gene Symbol Nsun4
Ensembl Gene ENSMUSG00000028706
Gene NameNOL1/NOP2/Sun domain family, member 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R7560 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location116032842-116053876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116051494 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 623 (T623I)
Ref Sequence ENSEMBL: ENSMUSP00000130430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030474] [ENSMUST00000030475] [ENSMUST00000165493]
Predicted Effect probably benign
Transcript: ENSMUST00000030474
SMART Domains Protein: ENSMUSP00000030474
Gene: ENSMUSG00000028706

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 28 199 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030475
SMART Domains Protein: ENSMUSP00000030475
Gene: ENSMUSG00000028706

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:Nol1_Nop2_Fmu 163 356 9.7e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165493
AA Change: T623I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130430
Gene: ENSMUSG00000028706
AA Change: T623I

DomainStartEndE-ValueType
low complexity region 91 124 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 553 565 N/A INTRINSIC
low complexity region 572 596 N/A INTRINSIC
low complexity region 677 700 N/A INTRINSIC
low complexity region 710 723 N/A INTRINSIC
low complexity region 733 756 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,284,615 Y4187C probably damaging Het
Acot12 A G 13: 91,784,391 D502G probably benign Het
Adrb1 T C 19: 56,722,688 V106A probably damaging Het
Ahcyl2 G T 6: 29,886,140 G352W probably damaging Het
Ahnak2 T G 12: 112,779,674 D446A Het
AI481877 T C 4: 59,076,140 N601S possibly damaging Het
Arhgap42 T C 9: 9,035,531 D270G probably benign Het
Atp2a1 A G 7: 126,459,656 V129A possibly damaging Het
B9d2 G A 7: 25,681,359 probably benign Het
Bace1 A T 9: 45,856,139 I207F possibly damaging Het
Blnk T A 19: 40,952,390 I190F possibly damaging Het
Bmp7 C T 2: 172,939,964 E36K possibly damaging Het
Brsk2 A G 7: 142,000,860 E654G probably benign Het
Cacna2d3 T C 14: 29,058,421 H661R probably benign Het
Cdh4 T C 2: 179,890,902 V719A probably benign Het
Cdkn2d G T 9: 21,289,244 P77H probably damaging Het
Chd3 A G 11: 69,356,270 V1024A probably damaging Het
Chsy1 T A 7: 66,171,244 M409K possibly damaging Het
Chsy1 T C 7: 66,171,571 L518P probably damaging Het
Cic G A 7: 25,272,853 V670M probably damaging Het
Clock A T 5: 76,242,891 probably null Het
Coro1a C A 7: 126,703,134 V14L probably damaging Het
Ctcfl C A 2: 173,118,406 C128F probably damaging Het
Cyb5b A G 8: 107,169,859 T71A probably damaging Het
Cyp2c40 C G 19: 39,807,214 V174L possibly damaging Het
D630045J12Rik T A 6: 38,196,627 Q202L possibly damaging Het
Dlgap2 T C 8: 14,822,697 probably null Het
Dnah1 T C 14: 31,304,983 I695V probably benign Het
Dst T A 1: 34,182,451 S2445R possibly damaging Het
Elob T C 17: 23,824,976 D83G probably benign Het
Elp4 T A 2: 105,794,588 D320V probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Exph5 A G 9: 53,375,773 I1385V probably benign Het
Fam104a C T 11: 113,663,389 G160D probably damaging Het
Fat3 A T 9: 15,996,842 D2621E probably damaging Het
Fbxl6 G T 15: 76,538,469 A83D probably benign Het
Fmo2 A G 1: 162,888,749 Y90H probably damaging Het
Fzd4 T A 7: 89,407,553 Y269* probably null Het
Grik5 T A 7: 25,058,526 I377F probably damaging Het
Havcr2 C A 11: 46,459,062 P137Q probably damaging Het
Hectd4 A G 5: 121,254,342 N223S possibly damaging Het
Hmcn2 A G 2: 31,457,173 S4792G probably benign Het
Hps3 T G 3: 20,030,452 I191L probably benign Het
Ica1l T A 1: 60,010,210 K195* probably null Het
Ift140 A G 17: 25,092,341 D1170G probably benign Het
Igflr1 T C 7: 30,567,351 F208S possibly damaging Het
Kcnma1 T C 14: 23,530,242 T313A probably benign Het
Krt6a T A 15: 101,690,559 I524F unknown Het
Lce1d G T 3: 92,685,841 H88Q unknown Het
Lrmda A G 14: 22,828,702 E177G probably benign Het
Lrrn3 T A 12: 41,452,713 N535I possibly damaging Het
Map2k4 T A 11: 65,775,757 I40L unknown Het
Map7d1 A G 4: 126,236,636 L459P probably damaging Het
Mipol1 A T 12: 57,306,073 N66I possibly damaging Het
Mycn A C 12: 12,940,291 F35V probably benign Het
Mzt2 A C 16: 15,862,805 M40R possibly damaging Het
N4bp2 T G 5: 65,791,115 L363V probably damaging Het
Nfat5 T A 8: 107,370,589 M1532K probably benign Het
Notch1 G A 2: 26,460,165 T2321M probably benign Het
Nr1h4 T C 10: 89,498,261 D89G probably benign Het
Nup155 T C 15: 8,155,047 S1309P probably benign Het
Olfr1100 T C 2: 86,978,778 Y6C probably benign Het
Olfr1508 T C 14: 52,463,394 N205S probably damaging Het
Pcsk5 A G 19: 17,836,972 F61L probably benign Het
Phrf1 A T 7: 141,231,225 probably null Het
Pkd1 G A 17: 24,573,631 E1431K probably benign Het
Pkd2 T A 5: 104,480,353 I431N probably damaging Het
Plcb2 A G 2: 118,715,643 L557P probably damaging Het
Poteg A G 8: 27,494,960 N449S probably benign Het
Ppargc1b C A 18: 61,312,210 G192W probably damaging Het
Rab13 T C 3: 90,224,899 S178P probably benign Het
Ralgds A G 2: 28,547,595 D571G probably damaging Het
Ror2 A G 13: 53,110,813 S748P probably benign Het
Sart1 A T 19: 5,384,877 L167Q probably damaging Het
Sept12 A G 16: 4,992,191 V160A possibly damaging Het
Sgo1 T C 17: 53,679,267 S299G probably benign Het
Slc35b4 T A 6: 34,163,361 D152V probably benign Het
Specc1 T A 11: 62,128,409 probably null Het
Synj1 G A 16: 90,940,483 T1308I probably benign Het
Thap12 T G 7: 98,710,231 L106V probably damaging Het
Togaram1 T C 12: 65,011,142 M1501T possibly damaging Het
Top2a G T 11: 99,000,837 N1153K probably benign Het
Trpm5 A G 7: 143,080,986 L658P probably damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Vmn1r80 A T 7: 12,193,823 I287F probably damaging Het
Vmn1r87 T C 7: 13,131,818 S181G probably damaging Het
Vmn2r71 A T 7: 85,623,907 H643L probably benign Het
Washc5 G A 15: 59,366,192 R228C probably damaging Het
Wdr72 T C 9: 74,210,126 S719P probably damaging Het
Xrcc3 G T 12: 111,807,902 D164E probably benign Het
Zc2hc1b G A 10: 13,168,785 R45C probably damaging Het
Zfp335 A G 2: 164,895,992 Y900H probably damaging Het
Zfp512b G A 2: 181,587,082 R697C probably damaging Het
Zfp60 T C 7: 27,749,136 Y410H probably damaging Het
Zfp60 T A 7: 27,749,271 C455S probably damaging Het
Zfp605 C T 5: 110,127,291 Q92* probably null Het
Zfp64 C T 2: 168,925,665 D676N probably damaging Het
Other mutations in Nsun4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Nsun4 UTSW 4 116035773 missense probably benign 0.01
R0306:Nsun4 UTSW 4 116052822 nonsense probably null
R0365:Nsun4 UTSW 4 116044738 missense probably damaging 1.00
R1440:Nsun4 UTSW 4 116052950 missense possibly damaging 0.83
R1624:Nsun4 UTSW 4 116034200 missense probably benign 0.05
R2058:Nsun4 UTSW 4 116053680 splice site probably null
R2262:Nsun4 UTSW 4 116052950 missense probably benign 0.27
R2438:Nsun4 UTSW 4 116048597 missense probably benign 0.01
R3029:Nsun4 UTSW 4 116052725 missense possibly damaging 0.83
R4012:Nsun4 UTSW 4 116051062 missense possibly damaging 0.66
R4162:Nsun4 UTSW 4 116034194 nonsense probably null
R4166:Nsun4 UTSW 4 116034051 missense probably damaging 0.98
R4277:Nsun4 UTSW 4 116034282 missense probably damaging 1.00
R4433:Nsun4 UTSW 4 116040130 missense possibly damaging 0.75
R4450:Nsun4 UTSW 4 116051256 nonsense probably null
R5077:Nsun4 UTSW 4 116048584 missense probably benign 0.00
R5307:Nsun4 UTSW 4 116034138 missense probably damaging 0.98
R5509:Nsun4 UTSW 4 116051777 missense possibly damaging 0.46
R5510:Nsun4 UTSW 4 116051777 missense possibly damaging 0.46
R6145:Nsun4 UTSW 4 116040206 missense probably damaging 1.00
R6520:Nsun4 UTSW 4 116044738 missense probably damaging 1.00
R6848:Nsun4 UTSW 4 116052934 missense possibly damaging 0.90
R7346:Nsun4 UTSW 4 116051838 missense probably benign 0.01
R7528:Nsun4 UTSW 4 116034194 nonsense probably null
R7719:Nsun4 UTSW 4 116052420 missense possibly damaging 0.82
R7798:Nsun4 UTSW 4 116051174 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AACAGCTGTAGGGGATCTGG -3'
(R):5'- TAATCCTGCTTTGCCCAGTAG -3'

Sequencing Primer
(F):5'- GGAGGGATTGTTCAGTGGGAC -3'
(R):5'- GCTTTGCCCAGTAGATATCCTAAGAG -3'
Posted On2019-10-17