Mutagenetix > Incidental Mutation

Incidental Mutation 'R0618:Mllt3'

58501

Institutional Source

Beutler Lab

Gene Symbol

Mllt3

Ensembl Gene

ENSMUSG00000028496

Gene Name

myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3

Synonyms

Af9, 3830408D16Rik, 2210011H10Rik, D4Ertd321e, 2610012I03Rik

MMRRC Submission

038807-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0618 (G1)

Quality Score

131

Status

Not validated

Chromosome

Chromosomal Location

87688162-87951601 bp(-) (GRCm39)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT to ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT at 87759504 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078090] [ENSMUST00000142454]

AlphaFold

A2AM29

Predicted Effect

probably benign
Transcript: ENSMUST00000078090

SMART Domains

Protein: ENSMUSP00000077232
Gene: ENSMUSG00000028496

Domain	Start	End	E-Value	Type
Pfam:YEATS	29	110	2.3e-29	PFAM
SCOP:d1l9ha_	126	173	9e-3	SMART
internal_repeat_1	195	214	9.17e-5	PROSPERO
internal_repeat_1	206	225	9.17e-5	PROSPERO
low complexity region	226	246	N/A	INTRINSIC
low complexity region	291	314	N/A	INTRINSIC
SCOP:d1qbkb_	315	467	7e-4	SMART
PDB:2LM0\|A	485	569	3e-48	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128930

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134555

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141526

Predicted Effect

probably benign
Transcript: ENSMUST00000142454

SMART Domains

Protein: ENSMUSP00000127376
Gene: ENSMUSG00000028496

Domain	Start	End	E-Value	Type
Pfam:YEATS	26	66	2.6e-15	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: About 50% of homozygous null mice die perinatally while the remaining 50% become runted and die within two weeks of birth with severe defects of the axial skeleton, including anterior homeotic transformation of the cervical and thoracic regions, a deformed atlas and an extra cervical vertebra. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 1 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Prag1	G	A	8: 36,566,987 (GRCm39)	R46H	probably damaging	Het

Other mutations in Mllt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Mllt3	APN	4	87,710,118 (GRCm39)	missense	probably benign	0.00
IGL01078:Mllt3	APN	4	87,798,297 (GRCm39)	splice site	probably benign
IGL01337:Mllt3	APN	4	87,759,057 (GRCm39)	missense	probably damaging	0.99
IGL02664:Mllt3	APN	4	87,949,860 (GRCm39)	missense	probably damaging	1.00
PIT4504001:Mllt3	UTSW	4	87,692,324 (GRCm39)	missense	probably damaging	1.00
R0226:Mllt3	UTSW	4	87,758,969 (GRCm39)	missense	probably benign	0.00
R0415:Mllt3	UTSW	4	87,759,576 (GRCm39)	utr 3 prime	probably benign
R0540:Mllt3	UTSW	4	87,759,281 (GRCm39)	missense	possibly damaging	0.73
R0932:Mllt3	UTSW	4	87,707,621 (GRCm39)	missense	probably damaging	0.99
R1713:Mllt3	UTSW	4	87,701,901 (GRCm39)	missense	probably damaging	1.00
R4748:Mllt3	UTSW	4	87,759,018 (GRCm39)	missense	possibly damaging	0.60
R4928:Mllt3	UTSW	4	87,700,642 (GRCm39)	splice site	probably null
R5086:Mllt3	UTSW	4	87,707,535 (GRCm39)	missense	probably damaging	0.99
R5186:Mllt3	UTSW	4	87,759,232 (GRCm39)	missense	probably benign	0.00
R5359:Mllt3	UTSW	4	87,759,164 (GRCm39)	missense	probably benign	0.21
R5371:Mllt3	UTSW	4	87,759,093 (GRCm39)	missense	possibly damaging	0.64
R5713:Mllt3	UTSW	4	87,759,448 (GRCm39)	missense	probably benign	0.01
R5787:Mllt3	UTSW	4	87,759,057 (GRCm39)	missense	probably damaging	0.99
R6346:Mllt3	UTSW	4	87,759,445 (GRCm39)	missense	probably damaging	1.00
R6462:Mllt3	UTSW	4	87,692,338 (GRCm39)	missense	probably damaging	1.00
R6621:Mllt3	UTSW	4	87,759,034 (GRCm39)	missense	possibly damaging	0.66
R6629:Mllt3	UTSW	4	87,759,504 (GRCm39)	utr 3 prime	probably benign
R7380:Mllt3	UTSW	4	87,710,180 (GRCm39)	missense	possibly damaging	0.85
R7600:Mllt3	UTSW	4	87,759,456 (GRCm39)	missense	probably benign	0.07
R8045:Mllt3	UTSW	4	87,759,350 (GRCm39)	missense	probably damaging	1.00
R8871:Mllt3	UTSW	4	87,759,552 (GRCm39)	utr 3 prime	probably benign
R9281:Mllt3	UTSW	4	87,707,566 (GRCm39)	missense	probably benign	0.12
R9300:Mllt3	UTSW	4	87,692,284 (GRCm39)	nonsense	probably null
R9341:Mllt3	UTSW	4	87,792,168 (GRCm39)	missense	possibly damaging	0.46
R9343:Mllt3	UTSW	4	87,792,168 (GRCm39)	missense	possibly damaging	0.46
R9544:Mllt3	UTSW	4	87,759,418 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

Posted On

2013-07-11