Incidental Mutation 'R7560:Specc1'
ID585050
Institutional Source Beutler Lab
Gene Symbol Specc1
Ensembl Gene ENSMUSG00000042331
Gene Namesperm antigen with calponin homology and coiled-coil domains 1
SynonymsCytsb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7560 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61956763-62223013 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 62128409 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000049836] [ENSMUST00000092415] [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000201671] [ENSMUST00000201723] [ENSMUST00000201723] [ENSMUST00000202178] [ENSMUST00000202178] [ENSMUST00000202179] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202389] [ENSMUST00000202744] [ENSMUST00000202744] [ENSMUST00000202905] [ENSMUST00000202905]
Predicted Effect probably null
Transcript: ENSMUST00000049836
SMART Domains Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000049836
SMART Domains Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092415
SMART Domains Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 832 844 N/A INTRINSIC
CH 883 981 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092415
SMART Domains Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 832 844 N/A INTRINSIC
CH 883 981 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108709
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108709
SMART Domains Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201015
SMART Domains Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
CH 303 401 1.4e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201015
SMART Domains Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
low complexity region 225 236 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
CH 303 401 1.4e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201364
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201364
SMART Domains Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
CH 954 1052 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000201624
SMART Domains Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201624
SMART Domains Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201671
SMART Domains Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201671
SMART Domains Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201723
SMART Domains Protein: ENSMUSP00000144542
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201723
SMART Domains Protein: ENSMUSP00000144542
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202178
SMART Domains Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202178
SMART Domains Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202179
SMART Domains Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
CH 874 972 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202179
SMART Domains Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
coiled coil region 79 116 N/A INTRINSIC
coiled coil region 144 179 N/A INTRINSIC
low complexity region 231 236 N/A INTRINSIC
coiled coil region 282 374 N/A INTRINSIC
coiled coil region 399 440 N/A INTRINSIC
coiled coil region 495 693 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
CH 874 972 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202389
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202389
SMART Domains Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202744
SMART Domains Protein: ENSMUSP00000144483
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202744
SMART Domains Protein: ENSMUSP00000144483
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
coiled coil region 23 113 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202905
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202905
SMART Domains Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
coiled coil region 159 196 N/A INTRINSIC
coiled coil region 224 259 N/A INTRINSIC
low complexity region 311 316 N/A INTRINSIC
coiled coil region 362 454 N/A INTRINSIC
coiled coil region 479 520 N/A INTRINSIC
coiled coil region 575 773 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
low complexity region 912 924 N/A INTRINSIC
CH 963 1061 2.69e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,284,615 Y4187C probably damaging Het
Acot12 A G 13: 91,784,391 D502G probably benign Het
Adrb1 T C 19: 56,722,688 V106A probably damaging Het
Ahcyl2 G T 6: 29,886,140 G352W probably damaging Het
Ahnak2 T G 12: 112,779,674 D446A Het
AI481877 T C 4: 59,076,140 N601S possibly damaging Het
Arhgap42 T C 9: 9,035,531 D270G probably benign Het
Atp2a1 A G 7: 126,459,656 V129A possibly damaging Het
B9d2 G A 7: 25,681,359 probably benign Het
Bace1 A T 9: 45,856,139 I207F possibly damaging Het
Blnk T A 19: 40,952,390 I190F possibly damaging Het
Bmp7 C T 2: 172,939,964 E36K possibly damaging Het
Brsk2 A G 7: 142,000,860 E654G probably benign Het
Cacna2d3 T C 14: 29,058,421 H661R probably benign Het
Cdh4 T C 2: 179,890,902 V719A probably benign Het
Cdkn2d G T 9: 21,289,244 P77H probably damaging Het
Chd3 A G 11: 69,356,270 V1024A probably damaging Het
Chsy1 T A 7: 66,171,244 M409K possibly damaging Het
Chsy1 T C 7: 66,171,571 L518P probably damaging Het
Cic G A 7: 25,272,853 V670M probably damaging Het
Clock A T 5: 76,242,891 probably null Het
Coro1a C A 7: 126,703,134 V14L probably damaging Het
Ctcfl C A 2: 173,118,406 C128F probably damaging Het
Cyb5b A G 8: 107,169,859 T71A probably damaging Het
Cyp2c40 C G 19: 39,807,214 V174L possibly damaging Het
D630045J12Rik T A 6: 38,196,627 Q202L possibly damaging Het
Dgkz T C 2: 91,942,815 probably benign Het
Dlgap2 T C 8: 14,822,697 probably null Het
Dnah1 T C 14: 31,304,983 I695V probably benign Het
Dst T A 1: 34,182,451 S2445R possibly damaging Het
Elob T C 17: 23,824,976 D83G probably benign Het
Elp4 T A 2: 105,794,588 D320V probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Exph5 A G 9: 53,375,773 I1385V probably benign Het
Fam104a C T 11: 113,663,389 G160D probably damaging Het
Fat3 A T 9: 15,996,842 D2621E probably damaging Het
Fbxl6 G T 15: 76,538,469 A83D probably benign Het
Fmo2 A G 1: 162,888,749 Y90H probably damaging Het
Fzd4 T A 7: 89,407,553 Y269* probably null Het
Grik5 T A 7: 25,058,526 I377F probably damaging Het
Havcr2 C A 11: 46,459,062 P137Q probably damaging Het
Hectd4 A G 5: 121,254,342 N223S possibly damaging Het
Hmcn2 A G 2: 31,457,173 S4792G probably benign Het
Hps3 T G 3: 20,030,452 I191L probably benign Het
Ica1l T A 1: 60,010,210 K195* probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ift140 A G 17: 25,092,341 D1170G probably benign Het
Igflr1 T C 7: 30,567,351 F208S possibly damaging Het
Kcnma1 T C 14: 23,530,242 T313A probably benign Het
Krt6a T A 15: 101,690,559 I524F unknown Het
Lce1d G T 3: 92,685,841 H88Q unknown Het
Lrmda A G 14: 22,828,702 E177G probably benign Het
Lrrn3 T A 12: 41,452,713 N535I possibly damaging Het
Map2k4 T A 11: 65,775,757 I40L unknown Het
Map7d1 A G 4: 126,236,636 L459P probably damaging Het
Mipol1 A T 12: 57,306,073 N66I possibly damaging Het
Mycn A C 12: 12,940,291 F35V probably benign Het
Mzt2 A C 16: 15,862,805 M40R possibly damaging Het
N4bp2 T G 5: 65,791,115 L363V probably damaging Het
Nfat5 T A 8: 107,370,589 M1532K probably benign Het
Notch1 G A 2: 26,460,165 T2321M probably benign Het
Nr1h4 T C 10: 89,498,261 D89G probably benign Het
Nsun4 G A 4: 116,051,494 T623I possibly damaging Het
Nup155 T C 15: 8,155,047 S1309P probably benign Het
Olfr1100 T C 2: 86,978,778 Y6C probably benign Het
Olfr1508 T C 14: 52,463,394 N205S probably damaging Het
Olfr561 T C 7: 102,781,682 S69P probably damaging Het
Pcsk5 A G 19: 17,836,972 F61L probably benign Het
Phrf1 A T 7: 141,231,225 probably null Het
Pkd1 G A 17: 24,573,631 E1431K probably benign Het
Pkd2 T A 5: 104,480,353 I431N probably damaging Het
Plcb2 A G 2: 118,715,643 L557P probably damaging Het
Poteg A G 8: 27,494,960 N449S probably benign Het
Ppargc1b C A 18: 61,312,210 G192W probably damaging Het
Rab13 T C 3: 90,224,899 S178P probably benign Het
Ralgds A G 2: 28,547,595 D571G probably damaging Het
Ror2 A G 13: 53,110,813 S748P probably benign Het
Sart1 A T 19: 5,384,877 L167Q probably damaging Het
Sept12 A G 16: 4,992,191 V160A possibly damaging Het
Sgo1 T C 17: 53,679,267 S299G probably benign Het
Slc35b4 T A 6: 34,163,361 D152V probably benign Het
Synj1 G A 16: 90,940,483 T1308I probably benign Het
Thap12 T G 7: 98,710,231 L106V probably damaging Het
Togaram1 T C 12: 65,011,142 M1501T possibly damaging Het
Top2a G T 11: 99,000,837 N1153K probably benign Het
Trpm5 A G 7: 143,080,986 L658P probably damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Vmn1r80 A T 7: 12,193,823 I287F probably damaging Het
Vmn1r87 T C 7: 13,131,818 S181G probably damaging Het
Vmn2r71 A T 7: 85,623,907 H643L probably benign Het
Washc5 G A 15: 59,366,192 R228C probably damaging Het
Wdr72 T C 9: 74,210,126 S719P probably damaging Het
Xrcc3 G T 12: 111,807,902 D164E probably benign Het
Zc2hc1b G A 10: 13,168,785 R45C probably damaging Het
Zfp335 A G 2: 164,895,992 Y900H probably damaging Het
Zfp512b G A 2: 181,587,082 R697C probably damaging Het
Zfp60 T C 7: 27,749,136 Y410H probably damaging Het
Zfp60 T A 7: 27,749,271 C455S probably damaging Het
Zfp605 C T 5: 110,127,291 Q92* probably null Het
Zfp64 C T 2: 168,925,665 D676N probably damaging Het
Other mutations in Specc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Specc1 APN 11 62118009 missense probably benign 0.02
IGL01953:Specc1 APN 11 62118296 missense probably benign 0.40
IGL02244:Specc1 APN 11 62128368 missense probably benign 0.41
IGL02257:Specc1 APN 11 62118417 missense probably damaging 1.00
IGL02512:Specc1 APN 11 62118389 missense probably damaging 1.00
IGL03147:Specc1 UTSW 11 62118282 missense probably benign
R0039:Specc1 UTSW 11 62029369 missense probably damaging 0.97
R0114:Specc1 UTSW 11 62146313 missense possibly damaging 0.92
R0635:Specc1 UTSW 11 62118903 missense probably damaging 1.00
R1514:Specc1 UTSW 11 62156532 missense probably damaging 1.00
R1604:Specc1 UTSW 11 62043057 missense probably damaging 1.00
R1717:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1719:Specc1 UTSW 11 62128392 missense possibly damaging 0.88
R1739:Specc1 UTSW 11 62118818 nonsense probably null
R1757:Specc1 UTSW 11 62119284 critical splice donor site probably null
R1990:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R1991:Specc1 UTSW 11 62029294 missense possibly damaging 0.87
R2063:Specc1 UTSW 11 62118296 missense probably benign 0.01
R2071:Specc1 UTSW 11 62117875 missense probably damaging 0.98
R2245:Specc1 UTSW 11 62131887 missense probably damaging 1.00
R3415:Specc1 UTSW 11 62118419 missense probably benign 0.29
R3831:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R3890:Specc1 UTSW 11 62151913 missense probably benign 0.00
R3891:Specc1 UTSW 11 62151913 missense probably benign 0.00
R4367:Specc1 UTSW 11 62118530 missense probably damaging 1.00
R4489:Specc1 UTSW 11 62151827 intron probably null
R4580:Specc1 UTSW 11 62219331 missense probably damaging 1.00
R4852:Specc1 UTSW 11 62211684 missense probably damaging 1.00
R4930:Specc1 UTSW 11 62118958 missense possibly damaging 0.93
R5016:Specc1 UTSW 11 62118957 missense possibly damaging 0.92
R5416:Specc1 UTSW 11 62118909 missense probably benign 0.00
R5650:Specc1 UTSW 11 62117967 missense probably damaging 1.00
R6158:Specc1 UTSW 11 62118124 missense probably damaging 0.99
R6329:Specc1 UTSW 11 62156553 missense probably damaging 1.00
R6374:Specc1 UTSW 11 62156592 missense possibly damaging 0.93
R6395:Specc1 UTSW 11 62132338 missense probably damaging 1.00
R6653:Specc1 UTSW 11 62146418 missense probably damaging 0.99
R6893:Specc1 UTSW 11 62132453 missense probably benign
R6898:Specc1 UTSW 11 62118336 missense probably benign
R7054:Specc1 UTSW 11 62117778 missense probably damaging 0.96
R7294:Specc1 UTSW 11 62118337 missense probably benign 0.01
R7376:Specc1 UTSW 11 62118252 missense probably benign 0.06
R7605:Specc1 UTSW 11 62211680 missense possibly damaging 0.91
R7621:Specc1 UTSW 11 62128384 missense possibly damaging 0.96
R7804:Specc1 UTSW 11 62205397 missense probably damaging 0.99
R7900:Specc1 UTSW 11 62219361 missense probably damaging 1.00
R7983:Specc1 UTSW 11 62219361 missense probably damaging 1.00
Z1177:Specc1 UTSW 11 62118767 missense possibly damaging 0.86
Z1177:Specc1 UTSW 11 62205423 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCGTACCTGAAAGAAGTCTGTG -3'
(R):5'- AGCTGCACAGGTAGGTACATC -3'

Sequencing Primer
(F):5'- GTCTGTGATCATCAAGCAGAAC -3'
(R):5'- GCTGCACAGGTAGGTACATCTAACC -3'
Posted On2019-10-17