Mutagenetix > Incidental Mutations

Incidental Mutation 'R7560:Ror2'

585061

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7560 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53110813 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 748 (S748P)

Ref Sequence

ENSEMBL: ENSMUSP00000021918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

Predicted Effect

probably benign
Transcript: ENSMUST00000021918
AA Change: S748P

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: S748P

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130235
AA Change: S736P

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: S736P

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,284,615	Y4187C	probably damaging	Het
Acot12	A	G	13: 91,784,391	D502G	probably benign	Het
Adrb1	T	C	19: 56,722,688	V106A	probably damaging	Het
Ahcyl2	G	T	6: 29,886,140	G352W	probably damaging	Het
Ahnak2	T	G	12: 112,779,674	D446A		Het
AI481877	T	C	4: 59,076,140	N601S	possibly damaging	Het
Arhgap42	T	C	9: 9,035,531	D270G	probably benign	Het
Atp2a1	A	G	7: 126,459,656	V129A	possibly damaging	Het
B9d2	G	A	7: 25,681,359		probably benign	Het
Bace1	A	T	9: 45,856,139	I207F	possibly damaging	Het
Blnk	T	A	19: 40,952,390	I190F	possibly damaging	Het
Bmp7	C	T	2: 172,939,964	E36K	possibly damaging	Het
Brsk2	A	G	7: 142,000,860	E654G	probably benign	Het
Cacna2d3	T	C	14: 29,058,421	H661R	probably benign	Het
Cdh4	T	C	2: 179,890,902	V719A	probably benign	Het
Cdkn2d	G	T	9: 21,289,244	P77H	probably damaging	Het
Chd3	A	G	11: 69,356,270	V1024A	probably damaging	Het
Chsy1	T	A	7: 66,171,244	M409K	possibly damaging	Het
Chsy1	T	C	7: 66,171,571	L518P	probably damaging	Het
Cic	G	A	7: 25,272,853	V670M	probably damaging	Het
Clock	A	T	5: 76,242,891		probably null	Het
Coro1a	C	A	7: 126,703,134	V14L	probably damaging	Het
Ctcfl	C	A	2: 173,118,406	C128F	probably damaging	Het
Cyb5b	A	G	8: 107,169,859	T71A	probably damaging	Het
Cyp2c40	C	G	19: 39,807,214	V174L	possibly damaging	Het
D630045J12Rik	T	A	6: 38,196,627	Q202L	possibly damaging	Het
Dlgap2	T	C	8: 14,822,697		probably null	Het
Dnah1	T	C	14: 31,304,983	I695V	probably benign	Het
Dst	T	A	1: 34,182,451	S2445R	possibly damaging	Het
Elob	T	C	17: 23,824,976	D83G	probably benign	Het
Elp4	T	A	2: 105,794,588	D320V	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Etfdh	T	C	3: 79,623,579	Y45C	probably damaging	Het
Exph5	A	G	9: 53,375,773	I1385V	probably benign	Het
Fam104a	C	T	11: 113,663,389	G160D	probably damaging	Het
Fat3	A	T	9: 15,996,842	D2621E	probably damaging	Het
Fbxl6	G	T	15: 76,538,469	A83D	probably benign	Het
Fmo2	A	G	1: 162,888,749	Y90H	probably damaging	Het
Fzd4	T	A	7: 89,407,553	Y269*	probably null	Het
Grik5	T	A	7: 25,058,526	I377F	probably damaging	Het
Havcr2	C	A	11: 46,459,062	P137Q	probably damaging	Het
Hectd4	A	G	5: 121,254,342	N223S	possibly damaging	Het
Hmcn2	A	G	2: 31,457,173	S4792G	probably benign	Het
Hps3	T	G	3: 20,030,452	I191L	probably benign	Het
Ica1l	T	A	1: 60,010,210	K195*	probably null	Het
Ift140	A	G	17: 25,092,341	D1170G	probably benign	Het
Igflr1	T	C	7: 30,567,351	F208S	possibly damaging	Het
Kcnma1	T	C	14: 23,530,242	T313A	probably benign	Het
Krt6a	T	A	15: 101,690,559	I524F	unknown	Het
Lce1d	G	T	3: 92,685,841	H88Q	unknown	Het
Lrmda	A	G	14: 22,828,702	E177G	probably benign	Het
Lrrn3	T	A	12: 41,452,713	N535I	possibly damaging	Het
Map2k4	T	A	11: 65,775,757	I40L	unknown	Het
Map7d1	A	G	4: 126,236,636	L459P	probably damaging	Het
Mipol1	A	T	12: 57,306,073	N66I	possibly damaging	Het
Mycn	A	C	12: 12,940,291	F35V	probably benign	Het
Mzt2	A	C	16: 15,862,805	M40R	possibly damaging	Het
N4bp2	T	G	5: 65,791,115	L363V	probably damaging	Het
Nfat5	T	A	8: 107,370,589	M1532K	probably benign	Het
Notch1	G	A	2: 26,460,165	T2321M	probably benign	Het
Nr1h4	T	C	10: 89,498,261	D89G	probably benign	Het
Nsun4	G	A	4: 116,051,494	T623I	possibly damaging	Het
Nup155	T	C	15: 8,155,047	S1309P	probably benign	Het
Olfr1100	T	C	2: 86,978,778	Y6C	probably benign	Het
Olfr1508	T	C	14: 52,463,394	N205S	probably damaging	Het
Pcsk5	A	G	19: 17,836,972	F61L	probably benign	Het
Phrf1	A	T	7: 141,231,225		probably null	Het
Pkd1	G	A	17: 24,573,631	E1431K	probably benign	Het
Pkd2	T	A	5: 104,480,353	I431N	probably damaging	Het
Plcb2	A	G	2: 118,715,643	L557P	probably damaging	Het
Poteg	A	G	8: 27,494,960	N449S	probably benign	Het
Ppargc1b	C	A	18: 61,312,210	G192W	probably damaging	Het
Rab13	T	C	3: 90,224,899	S178P	probably benign	Het
Ralgds	A	G	2: 28,547,595	D571G	probably damaging	Het
Sart1	A	T	19: 5,384,877	L167Q	probably damaging	Het
Sept12	A	G	16: 4,992,191	V160A	possibly damaging	Het
Sgo1	T	C	17: 53,679,267	S299G	probably benign	Het
Slc35b4	T	A	6: 34,163,361	D152V	probably benign	Het
Specc1	T	A	11: 62,128,409		probably null	Het
Synj1	G	A	16: 90,940,483	T1308I	probably benign	Het
Thap12	T	G	7: 98,710,231	L106V	probably damaging	Het
Togaram1	T	C	12: 65,011,142	M1501T	possibly damaging	Het
Top2a	G	T	11: 99,000,837	N1153K	probably benign	Het
Trpm5	A	G	7: 143,080,986	L658P	probably damaging	Het
Ttc21b	G	A	2: 66,217,204	A849V	possibly damaging	Het
Vmn1r80	A	T	7: 12,193,823	I287F	probably damaging	Het
Vmn1r87	T	C	7: 13,131,818	S181G	probably damaging	Het
Vmn2r71	A	T	7: 85,623,907	H643L	probably benign	Het
Washc5	G	A	15: 59,366,192	R228C	probably damaging	Het
Wdr72	T	C	9: 74,210,126	S719P	probably damaging	Het
Xrcc3	G	T	12: 111,807,902	D164E	probably benign	Het
Zc2hc1b	G	A	10: 13,168,785	R45C	probably damaging	Het
Zfp335	A	G	2: 164,895,992	Y900H	probably damaging	Het
Zfp512b	G	A	2: 181,587,082	R697C	probably damaging	Het
Zfp60	T	C	7: 27,749,136	Y410H	probably damaging	Het
Zfp60	T	A	7: 27,749,271	C455S	probably damaging	Het
Zfp605	C	T	5: 110,127,291	Q92*	probably null	Het
Zfp64	C	T	2: 168,925,665	D676N	probably damaging	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2031:Ror2	UTSW	13	53117330	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4824:Ror2	UTSW	13	53110683	missense	probably benign	0.10
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4951:Ror2	UTSW	13	53117147	missense	probably benign	0.00
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5380:Ror2	UTSW	13	53117149	missense	possibly damaging	0.73
R5469:Ror2	UTSW	13	53117339	missense	probably benign	0.00
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6717:Ror2	UTSW	13	53118982	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7092:Ror2	UTSW	13	53110236	missense	probably benign
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7254:Ror2	UTSW	13	53118720	missense	possibly damaging	0.72
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7746:Ror2	UTSW	13	53117225	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATGGGGATGAACTGAGGC -3'
(R):5'- ACTCTGACATCTGGTCCTACGG -3'

Sequencing Primer
(F):5'- GATGAACTGAGGCTGTGGG -3'
(R):5'- TTTAGCTACGGCCTGCAG -3'

Posted On

2019-10-17