Incidental Mutation 'R7560:Cacna2d3'
ID 585065
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha 2 delta-3, alpha2delta3
MMRRC Submission 045626-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7560 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 28626900-29443821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28780378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 661 (H661R)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567]
AlphaFold Q9Z1L5
Predicted Effect probably benign
Transcript: ENSMUST00000022567
AA Change: H661R

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: H661R

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,932,510 (GRCm39) D502G probably benign Het
Adrb1 T C 19: 56,711,120 (GRCm39) V106A probably damaging Het
Ahcyl2 G T 6: 29,886,139 (GRCm39) G352W probably damaging Het
Ahnak2 T G 12: 112,745,851 (GRCm39) D446A Het
Arhgap42 T C 9: 9,035,532 (GRCm39) D270G probably benign Het
Atp2a1 A G 7: 126,058,828 (GRCm39) V129A possibly damaging Het
B9d2 G A 7: 25,380,784 (GRCm39) probably benign Het
Bace1 A T 9: 45,767,437 (GRCm39) I207F possibly damaging Het
Blnk T A 19: 40,940,834 (GRCm39) I190F possibly damaging Het
Bmp7 C T 2: 172,781,757 (GRCm39) E36K possibly damaging Het
Brsk2 A G 7: 141,554,597 (GRCm39) E654G probably benign Het
Cdh4 T C 2: 179,532,695 (GRCm39) V719A probably benign Het
Cdkn2d G T 9: 21,200,540 (GRCm39) P77H probably damaging Het
Chd3 A G 11: 69,247,096 (GRCm39) V1024A probably damaging Het
Chsy1 T A 7: 65,820,992 (GRCm39) M409K possibly damaging Het
Chsy1 T C 7: 65,821,319 (GRCm39) L518P probably damaging Het
Cic G A 7: 24,972,278 (GRCm39) V670M probably damaging Het
Clock A T 5: 76,390,738 (GRCm39) probably null Het
Coro1a C A 7: 126,302,306 (GRCm39) V14L probably damaging Het
Ctcfl C A 2: 172,960,199 (GRCm39) C128F probably damaging Het
Cyb5b A G 8: 107,896,491 (GRCm39) T71A probably damaging Het
Cyp2c40 C G 19: 39,795,658 (GRCm39) V174L possibly damaging Het
D630045J12Rik T A 6: 38,173,562 (GRCm39) Q202L possibly damaging Het
Dgkz T C 2: 91,773,160 (GRCm39) probably benign Het
Dlgap2 T C 8: 14,872,697 (GRCm39) probably null Het
Dnah1 T C 14: 31,026,940 (GRCm39) I695V probably benign Het
Dst T A 1: 34,221,532 (GRCm39) S2445R possibly damaging Het
Elob T C 17: 24,043,950 (GRCm39) D83G probably benign Het
Elp4 T A 2: 105,624,933 (GRCm39) D320V probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Etfdh T C 3: 79,530,886 (GRCm39) Y45C probably damaging Het
Exph5 A G 9: 53,287,073 (GRCm39) I1385V probably benign Het
Fat3 A T 9: 15,908,138 (GRCm39) D2621E probably damaging Het
Fbxl6 G T 15: 76,422,669 (GRCm39) A83D probably benign Het
Fmo2 A G 1: 162,716,318 (GRCm39) Y90H probably damaging Het
Fzd4 T A 7: 89,056,761 (GRCm39) Y269* probably null Het
Grik5 T A 7: 24,757,951 (GRCm39) I377F probably damaging Het
Havcr2 C A 11: 46,349,889 (GRCm39) P137Q probably damaging Het
Hectd4 A G 5: 121,392,405 (GRCm39) N223S possibly damaging Het
Hmcn2 A G 2: 31,347,185 (GRCm39) S4792G probably benign Het
Hps3 T G 3: 20,084,616 (GRCm39) I191L probably benign Het
Ica1l T A 1: 60,049,369 (GRCm39) K195* probably null Het
Idh2 TCCCAGGGCC TCC 7: 79,748,079 (GRCm39) probably null Het
Ift140 A G 17: 25,311,315 (GRCm39) D1170G probably benign Het
Igflr1 T C 7: 30,266,776 (GRCm39) F208S possibly damaging Het
Kcnma1 T C 14: 23,580,310 (GRCm39) T313A probably benign Het
Krt6a T A 15: 101,598,994 (GRCm39) I524F unknown Het
Lce1d G T 3: 92,593,148 (GRCm39) H88Q unknown Het
Lrmda A G 14: 22,878,770 (GRCm39) E177G probably benign Het
Lrrn3 T A 12: 41,502,712 (GRCm39) N535I possibly damaging Het
Map2k4 T A 11: 65,666,583 (GRCm39) I40L unknown Het
Map7d1 A G 4: 126,130,429 (GRCm39) L459P probably damaging Het
Mipol1 A T 12: 57,352,859 (GRCm39) N66I possibly damaging Het
Mycn A C 12: 12,990,292 (GRCm39) F35V probably benign Het
Mzt2 A C 16: 15,680,669 (GRCm39) M40R possibly damaging Het
N4bp2 T G 5: 65,948,458 (GRCm39) L363V probably damaging Het
Nfat5 T A 8: 108,097,221 (GRCm39) M1532K probably benign Het
Notch1 G A 2: 26,350,177 (GRCm39) T2321M probably benign Het
Nr1h4 T C 10: 89,334,123 (GRCm39) D89G probably benign Het
Nsun4 G A 4: 115,908,691 (GRCm39) T623I possibly damaging Het
Nup155 T C 15: 8,184,531 (GRCm39) S1309P probably benign Het
Or4e1 T C 14: 52,700,851 (GRCm39) N205S probably damaging Het
Or51f5 T C 7: 102,430,889 (GRCm39) S69P probably damaging Het
Or8h10 T C 2: 86,809,122 (GRCm39) Y6C probably benign Het
Pcsk5 A G 19: 17,814,336 (GRCm39) F61L probably benign Het
Phrf1 A T 7: 140,811,138 (GRCm39) probably null Het
Pkd1 G A 17: 24,792,605 (GRCm39) E1431K probably benign Het
Pkd2 T A 5: 104,628,219 (GRCm39) I431N probably damaging Het
Plcb2 A G 2: 118,546,124 (GRCm39) L557P probably damaging Het
Poteg A G 8: 27,984,988 (GRCm39) N449S probably benign Het
Ppargc1b C A 18: 61,445,281 (GRCm39) G192W probably damaging Het
Rab13 T C 3: 90,132,206 (GRCm39) S178P probably benign Het
Ralgds A G 2: 28,437,607 (GRCm39) D571G probably damaging Het
Ror2 A G 13: 53,264,849 (GRCm39) S748P probably benign Het
Sart1 A T 19: 5,434,905 (GRCm39) L167Q probably damaging Het
Septin12 A G 16: 4,810,055 (GRCm39) V160A possibly damaging Het
Sgo1 T C 17: 53,986,295 (GRCm39) S299G probably benign Het
Shoc1 T C 4: 59,076,140 (GRCm39) N601S possibly damaging Het
Slc35b4 T A 6: 34,140,296 (GRCm39) D152V probably benign Het
Spata31h1 T C 10: 82,120,449 (GRCm39) Y4187C probably damaging Het
Specc1 T A 11: 62,019,235 (GRCm39) probably null Het
Synj1 G A 16: 90,737,371 (GRCm39) T1308I probably benign Het
Thap12 T G 7: 98,359,438 (GRCm39) L106V probably damaging Het
Togaram1 T C 12: 65,057,916 (GRCm39) M1501T possibly damaging Het
Top2a G T 11: 98,891,663 (GRCm39) N1153K probably benign Het
Trpm5 A G 7: 142,634,723 (GRCm39) L658P probably damaging Het
Ttc21b G A 2: 66,047,548 (GRCm39) A849V possibly damaging Het
Vcf1 C T 11: 113,554,215 (GRCm39) G160D probably damaging Het
Vmn1r80 A T 7: 11,927,750 (GRCm39) I287F probably damaging Het
Vmn1r87 T C 7: 12,865,745 (GRCm39) S181G probably damaging Het
Vmn2r71 A T 7: 85,273,115 (GRCm39) H643L probably benign Het
Washc5 G A 15: 59,238,041 (GRCm39) R228C probably damaging Het
Wdr72 T C 9: 74,117,408 (GRCm39) S719P probably damaging Het
Xrcc3 G T 12: 111,774,336 (GRCm39) D164E probably benign Het
Zc2hc1b G A 10: 13,044,529 (GRCm39) R45C probably damaging Het
Zfp335 A G 2: 164,737,912 (GRCm39) Y900H probably damaging Het
Zfp512b G A 2: 181,228,875 (GRCm39) R697C probably damaging Het
Zfp60 T C 7: 27,448,561 (GRCm39) Y410H probably damaging Het
Zfp60 T A 7: 27,448,696 (GRCm39) C455S probably damaging Het
Zfp605 C T 5: 110,275,157 (GRCm39) Q92* probably null Het
Zfp64 C T 2: 168,767,585 (GRCm39) D676N probably damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29,022,688 (GRCm39) splice site probably benign
IGL01150:Cacna2d3 APN 14 28,905,598 (GRCm39) missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28,665,548 (GRCm39) missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28,665,564 (GRCm39) missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 28,785,832 (GRCm39) unclassified probably benign
IGL02237:Cacna2d3 APN 14 29,068,954 (GRCm39) missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28,678,827 (GRCm39) splice site probably null
IGL02604:Cacna2d3 APN 14 29,015,066 (GRCm39) missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29,073,907 (GRCm39) splice site probably null
IGL02838:Cacna2d3 APN 14 29,022,785 (GRCm39) critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 28,786,276 (GRCm39) critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 28,780,388 (GRCm39) missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29,189,909 (GRCm39) missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28,674,243 (GRCm39) missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29,022,705 (GRCm39) missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29,442,834 (GRCm39) nonsense probably null
R0094:Cacna2d3 UTSW 14 28,892,460 (GRCm39) critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 28,767,601 (GRCm39) missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29,256,476 (GRCm39) missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29,189,906 (GRCm39) missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28,704,322 (GRCm39) missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 28,780,585 (GRCm39) missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 28,767,580 (GRCm39) missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 28,786,278 (GRCm39) splice site probably benign
R1312:Cacna2d3 UTSW 14 28,767,625 (GRCm39) missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28,703,137 (GRCm39) missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28,694,199 (GRCm39) missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28,691,171 (GRCm39) missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28,627,259 (GRCm39) missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 28,785,875 (GRCm39) missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29,068,880 (GRCm39) missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 28,905,538 (GRCm39) missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 28,825,670 (GRCm39) missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28,704,303 (GRCm39) missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29,015,092 (GRCm39) missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28,678,743 (GRCm39) splice site probably null
R4965:Cacna2d3 UTSW 14 28,704,289 (GRCm39) missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29,015,135 (GRCm39) missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29,068,987 (GRCm39) missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28,665,512 (GRCm39) critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29,442,891 (GRCm39) missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29,118,446 (GRCm39) missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28,630,278 (GRCm39) missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29,118,522 (GRCm39) missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 28,786,143 (GRCm39) unclassified probably benign
R6632:Cacna2d3 UTSW 14 28,627,222 (GRCm39) makesense probably null
R6706:Cacna2d3 UTSW 14 28,846,642 (GRCm39) critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 28,777,934 (GRCm39) missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28,691,275 (GRCm39) intron probably benign
R7009:Cacna2d3 UTSW 14 28,691,322 (GRCm39) start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28,691,260 (GRCm39) intron probably benign
R7146:Cacna2d3 UTSW 14 29,443,654 (GRCm39) missense unknown
R7427:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 28,780,575 (GRCm39) missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 28,767,501 (GRCm39) splice site probably null
R7703:Cacna2d3 UTSW 14 28,765,503 (GRCm39) missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 28,826,995 (GRCm39) splice site probably benign
R8096:Cacna2d3 UTSW 14 28,825,657 (GRCm39) missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28,704,328 (GRCm39) missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 28,819,772 (GRCm39) missense probably damaging 1.00
R8838:Cacna2d3 UTSW 14 28,691,220 (GRCm39) missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29,055,735 (GRCm39) missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29,068,971 (GRCm39) missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28,627,268 (GRCm39) missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 28,786,265 (GRCm39) missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29,069,120 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCCTATAGGAAAAGAGTTGGCTGG -3'
(R):5'- TGTCCTTGGCAGATGAATGG -3'

Sequencing Primer
(F):5'- TTGGCTGGGTAAAACATAGAAAACC -3'
(R):5'- GGTAAGAGCCAAGTGTCCTTCATC -3'
Posted On 2019-10-17