Incidental Mutation 'R7560:Dnah1'
ID585066
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7560 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31304983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 695 (I695V)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably benign
Transcript: ENSMUST00000048603
AA Change: I695V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: I695V

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,284,615 Y4187C probably damaging Het
Acot12 A G 13: 91,784,391 D502G probably benign Het
Adrb1 T C 19: 56,722,688 V106A probably damaging Het
Ahcyl2 G T 6: 29,886,140 G352W probably damaging Het
Ahnak2 T G 12: 112,779,674 D446A Het
AI481877 T C 4: 59,076,140 N601S possibly damaging Het
Arhgap42 T C 9: 9,035,531 D270G probably benign Het
Atp2a1 A G 7: 126,459,656 V129A possibly damaging Het
B9d2 G A 7: 25,681,359 probably benign Het
Bace1 A T 9: 45,856,139 I207F possibly damaging Het
Blnk T A 19: 40,952,390 I190F possibly damaging Het
Bmp7 C T 2: 172,939,964 E36K possibly damaging Het
Brsk2 A G 7: 142,000,860 E654G probably benign Het
Cacna2d3 T C 14: 29,058,421 H661R probably benign Het
Cdh4 T C 2: 179,890,902 V719A probably benign Het
Cdkn2d G T 9: 21,289,244 P77H probably damaging Het
Chd3 A G 11: 69,356,270 V1024A probably damaging Het
Chsy1 T A 7: 66,171,244 M409K possibly damaging Het
Chsy1 T C 7: 66,171,571 L518P probably damaging Het
Cic G A 7: 25,272,853 V670M probably damaging Het
Clock A T 5: 76,242,891 probably null Het
Coro1a C A 7: 126,703,134 V14L probably damaging Het
Ctcfl C A 2: 173,118,406 C128F probably damaging Het
Cyb5b A G 8: 107,169,859 T71A probably damaging Het
Cyp2c40 C G 19: 39,807,214 V174L possibly damaging Het
D630045J12Rik T A 6: 38,196,627 Q202L possibly damaging Het
Dgkz T C 2: 91,942,815 probably benign Het
Dlgap2 T C 8: 14,822,697 probably null Het
Dst T A 1: 34,182,451 S2445R possibly damaging Het
Elob T C 17: 23,824,976 D83G probably benign Het
Elp4 T A 2: 105,794,588 D320V probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Exph5 A G 9: 53,375,773 I1385V probably benign Het
Fam104a C T 11: 113,663,389 G160D probably damaging Het
Fat3 A T 9: 15,996,842 D2621E probably damaging Het
Fbxl6 G T 15: 76,538,469 A83D probably benign Het
Fmo2 A G 1: 162,888,749 Y90H probably damaging Het
Fzd4 T A 7: 89,407,553 Y269* probably null Het
Grik5 T A 7: 25,058,526 I377F probably damaging Het
Havcr2 C A 11: 46,459,062 P137Q probably damaging Het
Hectd4 A G 5: 121,254,342 N223S possibly damaging Het
Hmcn2 A G 2: 31,457,173 S4792G probably benign Het
Hps3 T G 3: 20,030,452 I191L probably benign Het
Ica1l T A 1: 60,010,210 K195* probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ift140 A G 17: 25,092,341 D1170G probably benign Het
Igflr1 T C 7: 30,567,351 F208S possibly damaging Het
Kcnma1 T C 14: 23,530,242 T313A probably benign Het
Krt6a T A 15: 101,690,559 I524F unknown Het
Lce1d G T 3: 92,685,841 H88Q unknown Het
Lrmda A G 14: 22,828,702 E177G probably benign Het
Lrrn3 T A 12: 41,452,713 N535I possibly damaging Het
Map2k4 T A 11: 65,775,757 I40L unknown Het
Map7d1 A G 4: 126,236,636 L459P probably damaging Het
Mipol1 A T 12: 57,306,073 N66I possibly damaging Het
Mycn A C 12: 12,940,291 F35V probably benign Het
Mzt2 A C 16: 15,862,805 M40R possibly damaging Het
N4bp2 T G 5: 65,791,115 L363V probably damaging Het
Nfat5 T A 8: 107,370,589 M1532K probably benign Het
Notch1 G A 2: 26,460,165 T2321M probably benign Het
Nr1h4 T C 10: 89,498,261 D89G probably benign Het
Nsun4 G A 4: 116,051,494 T623I possibly damaging Het
Nup155 T C 15: 8,155,047 S1309P probably benign Het
Olfr1100 T C 2: 86,978,778 Y6C probably benign Het
Olfr1508 T C 14: 52,463,394 N205S probably damaging Het
Olfr561 T C 7: 102,781,682 S69P probably damaging Het
Pcsk5 A G 19: 17,836,972 F61L probably benign Het
Phrf1 A T 7: 141,231,225 probably null Het
Pkd1 G A 17: 24,573,631 E1431K probably benign Het
Pkd2 T A 5: 104,480,353 I431N probably damaging Het
Plcb2 A G 2: 118,715,643 L557P probably damaging Het
Poteg A G 8: 27,494,960 N449S probably benign Het
Ppargc1b C A 18: 61,312,210 G192W probably damaging Het
Rab13 T C 3: 90,224,899 S178P probably benign Het
Ralgds A G 2: 28,547,595 D571G probably damaging Het
Ror2 A G 13: 53,110,813 S748P probably benign Het
Sart1 A T 19: 5,384,877 L167Q probably damaging Het
Sept12 A G 16: 4,992,191 V160A possibly damaging Het
Sgo1 T C 17: 53,679,267 S299G probably benign Het
Slc35b4 T A 6: 34,163,361 D152V probably benign Het
Specc1 T A 11: 62,128,409 probably null Het
Synj1 G A 16: 90,940,483 T1308I probably benign Het
Thap12 T G 7: 98,710,231 L106V probably damaging Het
Togaram1 T C 12: 65,011,142 M1501T possibly damaging Het
Top2a G T 11: 99,000,837 N1153K probably benign Het
Trpm5 A G 7: 143,080,986 L658P probably damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Vmn1r80 A T 7: 12,193,823 I287F probably damaging Het
Vmn1r87 T C 7: 13,131,818 S181G probably damaging Het
Vmn2r71 A T 7: 85,623,907 H643L probably benign Het
Washc5 G A 15: 59,366,192 R228C probably damaging Het
Wdr72 T C 9: 74,210,126 S719P probably damaging Het
Xrcc3 G T 12: 111,807,902 D164E probably benign Het
Zc2hc1b G A 10: 13,168,785 R45C probably damaging Het
Zfp335 A G 2: 164,895,992 Y900H probably damaging Het
Zfp512b G A 2: 181,587,082 R697C probably damaging Het
Zfp60 T C 7: 27,749,136 Y410H probably damaging Het
Zfp60 T A 7: 27,749,271 C455S probably damaging Het
Zfp605 C T 5: 110,127,291 Q92* probably null Het
Zfp64 C T 2: 168,925,665 D676N probably damaging Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
Faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31261590 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31300791 missense possibly damaging 0.80
R7499:Dnah1 UTSW 14 31315122 nonsense probably null
R7526:Dnah1 UTSW 14 31287876 missense possibly damaging 0.49
R7574:Dnah1 UTSW 14 31319908 missense probably benign 0.00
R7617:Dnah1 UTSW 14 31284782 missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31303906 missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31292338 missense probably benign 0.00
R7702:Dnah1 UTSW 14 31310909 missense probably benign
R7786:Dnah1 UTSW 14 31262521 missense probably damaging 1.00
R8002:Dnah1 UTSW 14 31298722 missense probably damaging 1.00
R8022:Dnah1 UTSW 14 31265014 missense probably damaging 1.00
R8032:Dnah1 UTSW 14 31271548 missense probably damaging 1.00
RF006:Dnah1 UTSW 14 31307875 missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GAGGAAGGTGCTAATGTCATTG -3'
(R):5'- GGATATGGTCCCTAAGTGAGCC -3'

Sequencing Primer
(F):5'- AATGTCATTGTTGTTCAGCTCCAG -3'
(R):5'- AGCCTCACAGTAGTGTCTGCATG -3'
Posted On2019-10-17