Incidental Mutation 'R7560:Synj1'
ID585074
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Namesynaptojanin 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7560 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location90936092-91011308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90940483 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1308 (T1308I)
Ref Sequence ENSEMBL: ENSMUSP00000128997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121759] [ENSMUST00000129743] [ENSMUST00000170853]
Predicted Effect
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: T1322I

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121759
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125032
SMART Domains Protein: ENSMUSP00000120399
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 80 110 N/A INTRINSIC
low complexity region 123 142 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000129743
AA Change: T102I
SMART Domains Protein: ENSMUSP00000123231
Gene: ENSMUSG00000022973
AA Change: T102I

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122675
Gene: ENSMUSG00000022973
AA Change: T187I

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 154 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170853
AA Change: T1308I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: T1308I

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231524
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,284,615 Y4187C probably damaging Het
Acot12 A G 13: 91,784,391 D502G probably benign Het
Adrb1 T C 19: 56,722,688 V106A probably damaging Het
Ahcyl2 G T 6: 29,886,140 G352W probably damaging Het
Ahnak2 T G 12: 112,779,674 D446A Het
AI481877 T C 4: 59,076,140 N601S possibly damaging Het
Arhgap42 T C 9: 9,035,531 D270G probably benign Het
Atp2a1 A G 7: 126,459,656 V129A possibly damaging Het
B9d2 G A 7: 25,681,359 probably benign Het
Bace1 A T 9: 45,856,139 I207F possibly damaging Het
Blnk T A 19: 40,952,390 I190F possibly damaging Het
Bmp7 C T 2: 172,939,964 E36K possibly damaging Het
Brsk2 A G 7: 142,000,860 E654G probably benign Het
Cacna2d3 T C 14: 29,058,421 H661R probably benign Het
Cdh4 T C 2: 179,890,902 V719A probably benign Het
Cdkn2d G T 9: 21,289,244 P77H probably damaging Het
Chd3 A G 11: 69,356,270 V1024A probably damaging Het
Chsy1 T A 7: 66,171,244 M409K possibly damaging Het
Chsy1 T C 7: 66,171,571 L518P probably damaging Het
Cic G A 7: 25,272,853 V670M probably damaging Het
Clock A T 5: 76,242,891 probably null Het
Coro1a C A 7: 126,703,134 V14L probably damaging Het
Ctcfl C A 2: 173,118,406 C128F probably damaging Het
Cyb5b A G 8: 107,169,859 T71A probably damaging Het
Cyp2c40 C G 19: 39,807,214 V174L possibly damaging Het
D630045J12Rik T A 6: 38,196,627 Q202L possibly damaging Het
Dlgap2 T C 8: 14,822,697 probably null Het
Dnah1 T C 14: 31,304,983 I695V probably benign Het
Dst T A 1: 34,182,451 S2445R possibly damaging Het
Elob T C 17: 23,824,976 D83G probably benign Het
Elp4 T A 2: 105,794,588 D320V probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Exph5 A G 9: 53,375,773 I1385V probably benign Het
Fam104a C T 11: 113,663,389 G160D probably damaging Het
Fat3 A T 9: 15,996,842 D2621E probably damaging Het
Fbxl6 G T 15: 76,538,469 A83D probably benign Het
Fmo2 A G 1: 162,888,749 Y90H probably damaging Het
Fzd4 T A 7: 89,407,553 Y269* probably null Het
Grik5 T A 7: 25,058,526 I377F probably damaging Het
Havcr2 C A 11: 46,459,062 P137Q probably damaging Het
Hectd4 A G 5: 121,254,342 N223S possibly damaging Het
Hmcn2 A G 2: 31,457,173 S4792G probably benign Het
Hps3 T G 3: 20,030,452 I191L probably benign Het
Ica1l T A 1: 60,010,210 K195* probably null Het
Ift140 A G 17: 25,092,341 D1170G probably benign Het
Igflr1 T C 7: 30,567,351 F208S possibly damaging Het
Kcnma1 T C 14: 23,530,242 T313A probably benign Het
Krt6a T A 15: 101,690,559 I524F unknown Het
Lce1d G T 3: 92,685,841 H88Q unknown Het
Lrmda A G 14: 22,828,702 E177G probably benign Het
Lrrn3 T A 12: 41,452,713 N535I possibly damaging Het
Map2k4 T A 11: 65,775,757 I40L unknown Het
Map7d1 A G 4: 126,236,636 L459P probably damaging Het
Mipol1 A T 12: 57,306,073 N66I possibly damaging Het
Mycn A C 12: 12,940,291 F35V probably benign Het
Mzt2 A C 16: 15,862,805 M40R possibly damaging Het
N4bp2 T G 5: 65,791,115 L363V probably damaging Het
Nfat5 T A 8: 107,370,589 M1532K probably benign Het
Notch1 G A 2: 26,460,165 T2321M probably benign Het
Nr1h4 T C 10: 89,498,261 D89G probably benign Het
Nsun4 G A 4: 116,051,494 T623I possibly damaging Het
Nup155 T C 15: 8,155,047 S1309P probably benign Het
Olfr1100 T C 2: 86,978,778 Y6C probably benign Het
Olfr1508 T C 14: 52,463,394 N205S probably damaging Het
Pcsk5 A G 19: 17,836,972 F61L probably benign Het
Phrf1 A T 7: 141,231,225 probably null Het
Pkd1 G A 17: 24,573,631 E1431K probably benign Het
Pkd2 T A 5: 104,480,353 I431N probably damaging Het
Plcb2 A G 2: 118,715,643 L557P probably damaging Het
Poteg A G 8: 27,494,960 N449S probably benign Het
Ppargc1b C A 18: 61,312,210 G192W probably damaging Het
Rab13 T C 3: 90,224,899 S178P probably benign Het
Ralgds A G 2: 28,547,595 D571G probably damaging Het
Ror2 A G 13: 53,110,813 S748P probably benign Het
Sart1 A T 19: 5,384,877 L167Q probably damaging Het
Sept12 A G 16: 4,992,191 V160A possibly damaging Het
Sgo1 T C 17: 53,679,267 S299G probably benign Het
Slc35b4 T A 6: 34,163,361 D152V probably benign Het
Specc1 T A 11: 62,128,409 probably null Het
Thap12 T G 7: 98,710,231 L106V probably damaging Het
Togaram1 T C 12: 65,011,142 M1501T possibly damaging Het
Top2a G T 11: 99,000,837 N1153K probably benign Het
Trpm5 A G 7: 143,080,986 L658P probably damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Vmn1r80 A T 7: 12,193,823 I287F probably damaging Het
Vmn1r87 T C 7: 13,131,818 S181G probably damaging Het
Vmn2r71 A T 7: 85,623,907 H643L probably benign Het
Washc5 G A 15: 59,366,192 R228C probably damaging Het
Wdr72 T C 9: 74,210,126 S719P probably damaging Het
Xrcc3 G T 12: 111,807,902 D164E probably benign Het
Zc2hc1b G A 10: 13,168,785 R45C probably damaging Het
Zfp335 A G 2: 164,895,992 Y900H probably damaging Het
Zfp512b G A 2: 181,587,082 R697C probably damaging Het
Zfp60 T C 7: 27,749,136 Y410H probably damaging Het
Zfp60 T A 7: 27,749,271 C455S probably damaging Het
Zfp605 C T 5: 110,127,291 Q92* probably null Het
Zfp64 C T 2: 168,925,665 D676N probably damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90951976 missense probably damaging 1.00
IGL01468:Synj1 APN 16 91010172 splice site probably benign
IGL02209:Synj1 APN 16 90987419 missense probably damaging 0.97
IGL02452:Synj1 APN 16 90961365 splice site probably benign
IGL02619:Synj1 APN 16 90974045 missense probably damaging 1.00
IGL02650:Synj1 APN 16 90976696 missense probably benign 0.03
IGL02708:Synj1 APN 16 90991462 missense probably damaging 1.00
IGL02863:Synj1 APN 16 90961434 missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90988168 missense probably damaging 0.99
IGL03295:Synj1 APN 16 90938430 missense probably benign 0.14
IGL03356:Synj1 APN 16 90987392 missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90964508 missense probably damaging 1.00
R0179:Synj1 UTSW 16 90964631 missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90938640 missense probably benign
R0426:Synj1 UTSW 16 90967354 missense probably damaging 1.00
R0486:Synj1 UTSW 16 90938263 utr 3 prime probably benign
R0515:Synj1 UTSW 16 90994022 missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90948087 missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0698:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0945:Synj1 UTSW 16 90960445 missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90946855 missense probably benign 0.05
R1562:Synj1 UTSW 16 90987402 missense probably benign 0.09
R1732:Synj1 UTSW 16 90964230 missense probably damaging 0.99
R1752:Synj1 UTSW 16 90938473 missense probably benign
R1785:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R1786:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R2011:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2012:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2065:Synj1 UTSW 16 90991649 critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90969329 missense probably damaging 1.00
R3026:Synj1 UTSW 16 90978734 missense probably damaging 1.00
R3151:Synj1 UTSW 16 90960626 missense probably damaging 0.96
R3946:Synj1 UTSW 16 91010096 missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90991603 missense probably damaging 1.00
R4472:Synj1 UTSW 16 90969181 critical splice donor site probably null
R4547:Synj1 UTSW 16 90988282 missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90973989 missense probably damaging 1.00
R4739:Synj1 UTSW 16 90955419 missense probably benign 0.00
R5027:Synj1 UTSW 16 90940519 intron probably null
R5428:Synj1 UTSW 16 90991518 missense probably damaging 0.98
R5586:Synj1 UTSW 16 91009977 intron probably benign
R5769:Synj1 UTSW 16 90938253 utr 3 prime probably benign
R6005:Synj1 UTSW 16 90969286 missense probably damaging 1.00
R6119:Synj1 UTSW 16 90938989 missense probably benign 0.30
R6313:Synj1 UTSW 16 90946815 missense probably benign 0.00
R6324:Synj1 UTSW 16 90938630 missense probably benign 0.00
R6549:Synj1 UTSW 16 90938677 missense probably benign
R6696:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6698:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6861:Synj1 UTSW 16 90963880 nonsense probably null
R7008:Synj1 UTSW 16 90993945 missense probably damaging 1.00
R7153:Synj1 UTSW 16 90948090 missense probably benign 0.04
R7393:Synj1 UTSW 16 90951999 missense probably damaging 0.99
R7510:Synj1 UTSW 16 90938677 missense probably benign
R7724:Synj1 UTSW 16 90961499 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCACTGGAAGGCTTTCTAAG -3'
(R):5'- AGGAGACCAGAACTGCATTC -3'

Sequencing Primer
(F):5'- ATGGAAAGGCATTAGCAAGAAC -3'
(R):5'- GACCAGAACTGCATTCTAACTGATGG -3'
Posted On2019-10-17