Incidental Mutation 'R7560:Ift140'
ID585077
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Nameintraflagellar transport 140
SynonymsTce5, Wdtc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7560 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25016091-25099495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25092341 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1170 (D1170G)
Ref Sequence ENSEMBL: ENSMUSP00000024983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
Predicted Effect probably benign
Transcript: ENSMUST00000024983
AA Change: D1170G

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: D1170G

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
AA Change: D1170G

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: D1170G

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,284,615 Y4187C probably damaging Het
Acot12 A G 13: 91,784,391 D502G probably benign Het
Adrb1 T C 19: 56,722,688 V106A probably damaging Het
Ahcyl2 G T 6: 29,886,140 G352W probably damaging Het
Ahnak2 T G 12: 112,779,674 D446A Het
AI481877 T C 4: 59,076,140 N601S possibly damaging Het
Arhgap42 T C 9: 9,035,531 D270G probably benign Het
Atp2a1 A G 7: 126,459,656 V129A possibly damaging Het
B9d2 G A 7: 25,681,359 probably benign Het
Bace1 A T 9: 45,856,139 I207F possibly damaging Het
Blnk T A 19: 40,952,390 I190F possibly damaging Het
Bmp7 C T 2: 172,939,964 E36K possibly damaging Het
Brsk2 A G 7: 142,000,860 E654G probably benign Het
Cacna2d3 T C 14: 29,058,421 H661R probably benign Het
Cdh4 T C 2: 179,890,902 V719A probably benign Het
Cdkn2d G T 9: 21,289,244 P77H probably damaging Het
Chd3 A G 11: 69,356,270 V1024A probably damaging Het
Chsy1 T A 7: 66,171,244 M409K possibly damaging Het
Chsy1 T C 7: 66,171,571 L518P probably damaging Het
Cic G A 7: 25,272,853 V670M probably damaging Het
Clock A T 5: 76,242,891 probably null Het
Coro1a C A 7: 126,703,134 V14L probably damaging Het
Ctcfl C A 2: 173,118,406 C128F probably damaging Het
Cyb5b A G 8: 107,169,859 T71A probably damaging Het
Cyp2c40 C G 19: 39,807,214 V174L possibly damaging Het
D630045J12Rik T A 6: 38,196,627 Q202L possibly damaging Het
Dgkz T C 2: 91,942,815 probably benign Het
Dlgap2 T C 8: 14,822,697 probably null Het
Dnah1 T C 14: 31,304,983 I695V probably benign Het
Dst T A 1: 34,182,451 S2445R possibly damaging Het
Elob T C 17: 23,824,976 D83G probably benign Het
Elp4 T A 2: 105,794,588 D320V probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Exph5 A G 9: 53,375,773 I1385V probably benign Het
Fam104a C T 11: 113,663,389 G160D probably damaging Het
Fat3 A T 9: 15,996,842 D2621E probably damaging Het
Fbxl6 G T 15: 76,538,469 A83D probably benign Het
Fmo2 A G 1: 162,888,749 Y90H probably damaging Het
Fzd4 T A 7: 89,407,553 Y269* probably null Het
Grik5 T A 7: 25,058,526 I377F probably damaging Het
Havcr2 C A 11: 46,459,062 P137Q probably damaging Het
Hectd4 A G 5: 121,254,342 N223S possibly damaging Het
Hmcn2 A G 2: 31,457,173 S4792G probably benign Het
Hps3 T G 3: 20,030,452 I191L probably benign Het
Ica1l T A 1: 60,010,210 K195* probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Igflr1 T C 7: 30,567,351 F208S possibly damaging Het
Kcnma1 T C 14: 23,530,242 T313A probably benign Het
Krt6a T A 15: 101,690,559 I524F unknown Het
Lce1d G T 3: 92,685,841 H88Q unknown Het
Lrmda A G 14: 22,828,702 E177G probably benign Het
Lrrn3 T A 12: 41,452,713 N535I possibly damaging Het
Map2k4 T A 11: 65,775,757 I40L unknown Het
Map7d1 A G 4: 126,236,636 L459P probably damaging Het
Mipol1 A T 12: 57,306,073 N66I possibly damaging Het
Mycn A C 12: 12,940,291 F35V probably benign Het
Mzt2 A C 16: 15,862,805 M40R possibly damaging Het
N4bp2 T G 5: 65,791,115 L363V probably damaging Het
Nfat5 T A 8: 107,370,589 M1532K probably benign Het
Notch1 G A 2: 26,460,165 T2321M probably benign Het
Nr1h4 T C 10: 89,498,261 D89G probably benign Het
Nsun4 G A 4: 116,051,494 T623I possibly damaging Het
Nup155 T C 15: 8,155,047 S1309P probably benign Het
Olfr1100 T C 2: 86,978,778 Y6C probably benign Het
Olfr1508 T C 14: 52,463,394 N205S probably damaging Het
Olfr561 T C 7: 102,781,682 S69P probably damaging Het
Pcsk5 A G 19: 17,836,972 F61L probably benign Het
Phrf1 A T 7: 141,231,225 probably null Het
Pkd1 G A 17: 24,573,631 E1431K probably benign Het
Pkd2 T A 5: 104,480,353 I431N probably damaging Het
Plcb2 A G 2: 118,715,643 L557P probably damaging Het
Poteg A G 8: 27,494,960 N449S probably benign Het
Ppargc1b C A 18: 61,312,210 G192W probably damaging Het
Rab13 T C 3: 90,224,899 S178P probably benign Het
Ralgds A G 2: 28,547,595 D571G probably damaging Het
Ror2 A G 13: 53,110,813 S748P probably benign Het
Sart1 A T 19: 5,384,877 L167Q probably damaging Het
Sept12 A G 16: 4,992,191 V160A possibly damaging Het
Sgo1 T C 17: 53,679,267 S299G probably benign Het
Slc35b4 T A 6: 34,163,361 D152V probably benign Het
Specc1 T A 11: 62,128,409 probably null Het
Synj1 G A 16: 90,940,483 T1308I probably benign Het
Thap12 T G 7: 98,710,231 L106V probably damaging Het
Togaram1 T C 12: 65,011,142 M1501T possibly damaging Het
Top2a G T 11: 99,000,837 N1153K probably benign Het
Trpm5 A G 7: 143,080,986 L658P probably damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Vmn1r80 A T 7: 12,193,823 I287F probably damaging Het
Vmn1r87 T C 7: 13,131,818 S181G probably damaging Het
Vmn2r71 A T 7: 85,623,907 H643L probably benign Het
Washc5 G A 15: 59,366,192 R228C probably damaging Het
Wdr72 T C 9: 74,210,126 S719P probably damaging Het
Xrcc3 G T 12: 111,807,902 D164E probably benign Het
Zc2hc1b G A 10: 13,168,785 R45C probably damaging Het
Zfp335 A G 2: 164,895,992 Y900H probably damaging Het
Zfp512b G A 2: 181,587,082 R697C probably damaging Het
Zfp60 T C 7: 27,749,136 Y410H probably damaging Het
Zfp60 T A 7: 27,749,271 C455S probably damaging Het
Zfp605 C T 5: 110,127,291 Q92* probably null Het
Zfp64 C T 2: 168,925,665 D676N probably damaging Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGTCTGTCCCTTAGCCTG -3'
(R):5'- GTTGAGATATACTGGCCCACAC -3'

Sequencing Primer
(F):5'- TGACTCAGCCTCGTGCAGTAG -3'
(R):5'- ACACAGACTCACCTTTAGCTTG -3'
Posted On2019-10-17