Mutagenetix > Incidental Mutations

Incidental Mutation 'R7560:Ift140'

585077

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7560 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25092341 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1170 (D1170G)

Ref Sequence

ENSEMBL: ENSMUSP00000024983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: D1170G

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: D1170G

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: D1170G

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: D1170G

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (100/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,284,615	Y4187C	probably damaging	Het
Acot12	A	G	13: 91,784,391	D502G	probably benign	Het
Adrb1	T	C	19: 56,722,688	V106A	probably damaging	Het
Ahcyl2	G	T	6: 29,886,140	G352W	probably damaging	Het
Ahnak2	T	G	12: 112,779,674	D446A		Het
AI481877	T	C	4: 59,076,140	N601S	possibly damaging	Het
Arhgap42	T	C	9: 9,035,531	D270G	probably benign	Het
Atp2a1	A	G	7: 126,459,656	V129A	possibly damaging	Het
B9d2	G	A	7: 25,681,359		probably benign	Het
Bace1	A	T	9: 45,856,139	I207F	possibly damaging	Het
Blnk	T	A	19: 40,952,390	I190F	possibly damaging	Het
Bmp7	C	T	2: 172,939,964	E36K	possibly damaging	Het
Brsk2	A	G	7: 142,000,860	E654G	probably benign	Het
Cacna2d3	T	C	14: 29,058,421	H661R	probably benign	Het
Cdh4	T	C	2: 179,890,902	V719A	probably benign	Het
Cdkn2d	G	T	9: 21,289,244	P77H	probably damaging	Het
Chd3	A	G	11: 69,356,270	V1024A	probably damaging	Het
Chsy1	T	A	7: 66,171,244	M409K	possibly damaging	Het
Chsy1	T	C	7: 66,171,571	L518P	probably damaging	Het
Cic	G	A	7: 25,272,853	V670M	probably damaging	Het
Clock	A	T	5: 76,242,891		probably null	Het
Coro1a	C	A	7: 126,703,134	V14L	probably damaging	Het
Ctcfl	C	A	2: 173,118,406	C128F	probably damaging	Het
Cyb5b	A	G	8: 107,169,859	T71A	probably damaging	Het
Cyp2c40	C	G	19: 39,807,214	V174L	possibly damaging	Het
D630045J12Rik	T	A	6: 38,196,627	Q202L	possibly damaging	Het
Dgkz	T	C	2: 91,942,815		probably benign	Het
Dlgap2	T	C	8: 14,822,697		probably null	Het
Dnah1	T	C	14: 31,304,983	I695V	probably benign	Het
Dst	T	A	1: 34,182,451	S2445R	possibly damaging	Het
Elob	T	C	17: 23,824,976	D83G	probably benign	Het
Elp4	T	A	2: 105,794,588	D320V	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Etfdh	T	C	3: 79,623,579	Y45C	probably damaging	Het
Exph5	A	G	9: 53,375,773	I1385V	probably benign	Het
Fam104a	C	T	11: 113,663,389	G160D	probably damaging	Het
Fat3	A	T	9: 15,996,842	D2621E	probably damaging	Het
Fbxl6	G	T	15: 76,538,469	A83D	probably benign	Het
Fmo2	A	G	1: 162,888,749	Y90H	probably damaging	Het
Fzd4	T	A	7: 89,407,553	Y269*	probably null	Het
Grik5	T	A	7: 25,058,526	I377F	probably damaging	Het
Havcr2	C	A	11: 46,459,062	P137Q	probably damaging	Het
Hectd4	A	G	5: 121,254,342	N223S	possibly damaging	Het
Hmcn2	A	G	2: 31,457,173	S4792G	probably benign	Het
Hps3	T	G	3: 20,030,452	I191L	probably benign	Het
Ica1l	T	A	1: 60,010,210	K195*	probably null	Het
Idh2	TCCCAGGGCC	TCC	7: 80,098,331		probably null	Het
Igflr1	T	C	7: 30,567,351	F208S	possibly damaging	Het
Kcnma1	T	C	14: 23,530,242	T313A	probably benign	Het
Krt6a	T	A	15: 101,690,559	I524F	unknown	Het
Lce1d	G	T	3: 92,685,841	H88Q	unknown	Het
Lrmda	A	G	14: 22,828,702	E177G	probably benign	Het
Lrrn3	T	A	12: 41,452,713	N535I	possibly damaging	Het
Map2k4	T	A	11: 65,775,757	I40L	unknown	Het
Map7d1	A	G	4: 126,236,636	L459P	probably damaging	Het
Mipol1	A	T	12: 57,306,073	N66I	possibly damaging	Het
Mycn	A	C	12: 12,940,291	F35V	probably benign	Het
Mzt2	A	C	16: 15,862,805	M40R	possibly damaging	Het
N4bp2	T	G	5: 65,791,115	L363V	probably damaging	Het
Nfat5	T	A	8: 107,370,589	M1532K	probably benign	Het
Notch1	G	A	2: 26,460,165	T2321M	probably benign	Het
Nr1h4	T	C	10: 89,498,261	D89G	probably benign	Het
Nsun4	G	A	4: 116,051,494	T623I	possibly damaging	Het
Nup155	T	C	15: 8,155,047	S1309P	probably benign	Het
Olfr1100	T	C	2: 86,978,778	Y6C	probably benign	Het
Olfr1508	T	C	14: 52,463,394	N205S	probably damaging	Het
Olfr561	T	C	7: 102,781,682	S69P	probably damaging	Het
Pcsk5	A	G	19: 17,836,972	F61L	probably benign	Het
Phrf1	A	T	7: 141,231,225		probably null	Het
Pkd1	G	A	17: 24,573,631	E1431K	probably benign	Het
Pkd2	T	A	5: 104,480,353	I431N	probably damaging	Het
Plcb2	A	G	2: 118,715,643	L557P	probably damaging	Het
Poteg	A	G	8: 27,494,960	N449S	probably benign	Het
Ppargc1b	C	A	18: 61,312,210	G192W	probably damaging	Het
Rab13	T	C	3: 90,224,899	S178P	probably benign	Het
Ralgds	A	G	2: 28,547,595	D571G	probably damaging	Het
Ror2	A	G	13: 53,110,813	S748P	probably benign	Het
Sart1	A	T	19: 5,384,877	L167Q	probably damaging	Het
Sept12	A	G	16: 4,992,191	V160A	possibly damaging	Het
Sgo1	T	C	17: 53,679,267	S299G	probably benign	Het
Slc35b4	T	A	6: 34,163,361	D152V	probably benign	Het
Specc1	T	A	11: 62,128,409		probably null	Het
Synj1	G	A	16: 90,940,483	T1308I	probably benign	Het
Thap12	T	G	7: 98,710,231	L106V	probably damaging	Het
Togaram1	T	C	12: 65,011,142	M1501T	possibly damaging	Het
Top2a	G	T	11: 99,000,837	N1153K	probably benign	Het
Trpm5	A	G	7: 143,080,986	L658P	probably damaging	Het
Ttc21b	G	A	2: 66,217,204	A849V	possibly damaging	Het
Vmn1r80	A	T	7: 12,193,823	I287F	probably damaging	Het
Vmn1r87	T	C	7: 13,131,818	S181G	probably damaging	Het
Vmn2r71	A	T	7: 85,623,907	H643L	probably benign	Het
Washc5	G	A	15: 59,366,192	R228C	probably damaging	Het
Wdr72	T	C	9: 74,210,126	S719P	probably damaging	Het
Xrcc3	G	T	12: 111,807,902	D164E	probably benign	Het
Zc2hc1b	G	A	10: 13,168,785	R45C	probably damaging	Het
Zfp335	A	G	2: 164,895,992	Y900H	probably damaging	Het
Zfp512b	G	A	2: 181,587,082	R697C	probably damaging	Het
Zfp60	T	C	7: 27,749,136	Y410H	probably damaging	Het
Zfp60	T	A	7: 27,749,271	C455S	probably damaging	Het
Zfp605	C	T	5: 110,127,291	Q92*	probably null	Het
Zfp64	C	T	2: 168,925,665	D676N	probably damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAGTCTGTCCCTTAGCCTG -3'
(R):5'- GTTGAGATATACTGGCCCACAC -3'

Sequencing Primer
(F):5'- TGACTCAGCCTCGTGCAGTAG -3'
(R):5'- ACACAGACTCACCTTTAGCTTG -3'

Posted On

2019-10-17