Incidental Mutation 'R0619:Crat'
ID58508
Institutional Source Beutler Lab
Gene Symbol Crat
Ensembl Gene ENSMUSG00000026853
Gene Namecarnitine acetyltransferase
SynonymsCARAT
MMRRC Submission 038808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0619 (G1)
Quality Score158
Status Not validated
Chromosome2
Chromosomal Location30400471-30415813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30409984 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 128 (D128G)
Ref Sequence ENSEMBL: ENSMUSP00000099919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028207] [ENSMUST00000102854] [ENSMUST00000102855] [ENSMUST00000129494] [ENSMUST00000132981] [ENSMUST00000134120] [ENSMUST00000142096] [ENSMUST00000156702]
Predicted Effect probably benign
Transcript: ENSMUST00000028207
AA Change: D128G

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028207
Gene: ENSMUSG00000026853
AA Change: D128G

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 616 1.9e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102854
AA Change: D107G

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099918
Gene: ENSMUSG00000026853
AA Change: D107G

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 13 595 1.8e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102855
AA Change: D128G

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099919
Gene: ENSMUSG00000026853
AA Change: D128G

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 35 615 2.4e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128593
Predicted Effect probably benign
Transcript: ENSMUST00000129494
Predicted Effect probably benign
Transcript: ENSMUST00000132981
AA Change: D128G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118507
Gene: ENSMUSG00000026853
AA Change: D128G

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 76 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134920
Predicted Effect probably benign
Transcript: ENSMUST00000142096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146822
Predicted Effect probably benign
Transcript: ENSMUST00000155790
SMART Domains Protein: ENSMUSP00000122814
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 133 2.4e-51 PFAM
Pfam:Carn_acyltransf 128 190 8.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156702
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes carnitine O-acetyltransferase, a member of the carnitine acyltransferase family and a key metabolic pathway enzyme which plays an important role in energy homeostasis and fat metabolism. This enzyme catalyzes the reversible transfer of acyl groups from an acyl-CoA thioester to carnitine and regulates the ratio of acyl-CoA/CoA. It is found in both the mitochondria and the peroxisome. Alternative splicing results in transcript variants encoding different isoforms that may localize to different subcellular compartments. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice with muscle specific loss of function display increased circulating glucose level, impaired glucose tolerance, insulin resistance, decreased circulating triglyceride and free fatty acid levels, increased susceptibility to diet-induced obesity and abnormal mitochondrial physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,613,000 D74N probably benign Het
Adgre4 T A 17: 55,820,679 V573D possibly damaging Het
Ak7 A G 12: 105,733,511 K230E probably damaging Het
Amdhd2 T C 17: 24,156,588 D375G possibly damaging Het
Anpep T C 7: 79,841,009 E253G probably benign Het
Bbs7 A G 3: 36,607,576 L158S probably benign Het
BC037034 A G 5: 138,263,826 probably benign Het
Bdp1 T C 13: 100,037,858 T2057A probably benign Het
C2 G T 17: 34,872,503 H61Q probably damaging Het
Ccdc18 A G 5: 108,180,416 K661E probably benign Het
Cdh23 C T 10: 60,433,777 V655I probably damaging Het
Cep78 T C 19: 15,978,862 T238A probably damaging Het
Ces2a T A 8: 104,736,110 N110K probably benign Het
Dclre1a A T 19: 56,545,409 M233K probably benign Het
Dsg4 T C 18: 20,461,359 V515A probably benign Het
Fer1l6 T C 15: 58,662,935 probably null Het
Fryl T C 5: 73,068,731 D1863G probably benign Het
Fsip2 T A 2: 82,944,140 L57Q probably damaging Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Iqsec1 T C 6: 90,670,406 probably null Het
Kcnn3 A C 3: 89,652,030 T536P probably damaging Het
Kctd3 T C 1: 188,978,643 D441G probably damaging Het
Kifc3 G A 8: 95,102,665 T528M probably benign Het
Kmt2c G A 5: 25,298,916 T3798I probably benign Het
Map1a T A 2: 121,305,255 M1946K probably damaging Het
Mfhas1 T A 8: 35,590,675 V768E probably benign Het
Mroh8 C A 2: 157,265,081 V223F possibly damaging Het
Mss51 A T 14: 20,487,573 V30E probably benign Het
Mtmr10 G A 7: 64,321,213 R392H probably benign Het
Mup3 T C 4: 62,085,961 N105S probably benign Het
Myh7b T C 2: 155,611,722 M22T probably benign Het
Olfr1034 T A 2: 86,047,311 Y276* probably null Het
Olfr170 T A 16: 19,606,272 Y132F probably damaging Het
Olfr97 T A 17: 37,232,155 I72F possibly damaging Het
Os9 A G 10: 127,120,991 I43T probably damaging Het
Pkhd1l1 T C 15: 44,483,838 L200P probably damaging Het
Ptpru C T 4: 131,820,887 V100M possibly damaging Het
Rnf6 G A 5: 146,210,721 R496C possibly damaging Het
Rsad1 C T 11: 94,542,639 R407Q probably damaging Het
Rspo3 T C 10: 29,504,637 D127G probably damaging Het
Sbf2 T A 7: 110,310,262 T1760S possibly damaging Het
Sh2d3c T A 2: 32,753,025 V588E probably damaging Het
Siglech A T 7: 55,769,162 T238S probably benign Het
Slc15a2 T A 16: 36,759,307 N328I probably damaging Het
Slc16a11 G T 11: 70,215,032 G94C probably damaging Het
Stub1 T C 17: 25,831,322 probably null Het
Tacc2 T A 7: 130,716,753 V40D probably damaging Het
Tagln3 C A 16: 45,724,272 R12L probably damaging Het
Tsen54 A G 11: 115,815,064 E69G probably damaging Het
Tsks A G 7: 44,950,834 E150G probably damaging Het
Ubap2l A C 3: 90,017,220 V680G probably benign Het
Usp16 A T 16: 87,472,164 H315L probably benign Het
Vav2 A G 2: 27,296,121 probably null Het
Zfc3h1 T C 10: 115,420,810 F1562L possibly damaging Het
Zfp764 C A 7: 127,406,541 V22L probably benign Het
Other mutations in Crat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Crat APN 2 30405187 missense probably damaging 0.99
IGL01357:Crat APN 2 30407724 missense probably damaging 1.00
IGL01538:Crat APN 2 30409966 missense probably damaging 1.00
IGL01973:Crat APN 2 30405481 missense probably damaging 0.98
IGL02228:Crat APN 2 30413182 missense probably damaging 1.00
IGL02408:Crat APN 2 30407134 missense probably damaging 1.00
IGL02569:Crat APN 2 30404530 missense probably damaging 0.99
IGL02637:Crat APN 2 30406389 missense probably benign 0.06
IGL02983:Crat APN 2 30404526 critical splice donor site probably null
IGL03395:Crat APN 2 30404966 missense probably benign 0.11
Charlie UTSW 2 30403541 missense probably damaging 1.00
veruca UTSW 2 30403628 unclassified probably benign
R0136:Crat UTSW 2 30407030 missense probably benign
R0389:Crat UTSW 2 30403628 unclassified probably benign
R0443:Crat UTSW 2 30403628 unclassified probably benign
R1938:Crat UTSW 2 30413061 missense probably benign
R1990:Crat UTSW 2 30405048 missense possibly damaging 0.93
R2113:Crat UTSW 2 30402642 missense probably benign 0.00
R2655:Crat UTSW 2 30402691 missense probably damaging 1.00
R3150:Crat UTSW 2 30413859 critical splice donor site probably null
R4231:Crat UTSW 2 30413011 missense possibly damaging 0.95
R4553:Crat UTSW 2 30408217 missense probably benign 0.00
R4592:Crat UTSW 2 30415366 utr 5 prime probably benign
R4718:Crat UTSW 2 30408164 nonsense probably null
R4808:Crat UTSW 2 30410021 missense probably benign 0.01
R4982:Crat UTSW 2 30407136 critical splice acceptor site probably null
R5473:Crat UTSW 2 30407714 missense probably damaging 1.00
R6049:Crat UTSW 2 30403541 missense probably damaging 1.00
R6223:Crat UTSW 2 30407030 missense probably benign 0.07
R6774:Crat UTSW 2 30413183 missense probably damaging 1.00
R6885:Crat UTSW 2 30415196 splice site probably benign
R7376:Crat UTSW 2 30406465 missense probably damaging 1.00
R7407:Crat UTSW 2 30404565 missense probably benign 0.01
R7408:Crat UTSW 2 30404565 missense probably benign 0.01
R7410:Crat UTSW 2 30404565 missense probably benign 0.01
R7467:Crat UTSW 2 30409982 missense probably damaging 1.00
R7484:Crat UTSW 2 30404565 missense probably benign 0.01
R7514:Crat UTSW 2 30404565 missense probably benign 0.01
R7582:Crat UTSW 2 30404565 missense probably benign 0.01
R7584:Crat UTSW 2 30404565 missense probably benign 0.01
R7585:Crat UTSW 2 30404565 missense probably benign 0.01
R7620:Crat UTSW 2 30408078 missense probably damaging 0.99
R7685:Crat UTSW 2 30404565 missense probably benign 0.01
R7686:Crat UTSW 2 30404565 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAAAGCCCTGGCATGAGAAG -3'
(R):5'- TTCTCTAGGCAGTACCAGTCGCAC -3'

Sequencing Primer
(F):5'- tcctcactgctctgagcc -3'
(R):5'- GCTGTGAACCTCAGCACTTG -3'
Posted On2013-07-11