Mutagenetix > Incidental Mutations

Incidental Mutation 'R7560:Blnk'

585084

Institutional Source

Beutler Lab

Gene Symbol

Blnk

Ensembl Gene

ENSMUSG00000061132

Gene Name

B cell linker

Synonyms

BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R7560 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40928927-40994535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40952390 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 190 (I190F)

Ref Sequence

ENSEMBL: ENSMUSP00000057844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]

PDB Structure

Solution structure of the SH2 domain from mouse B-cell linker protein BLNK [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054769
AA Change: I190F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: I190F

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	345	436	3.07e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117695
AA Change: I190F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: I190F

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	342	433	3.07e-19	SMART

Meta Mutation Damage Score

0.0888

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (100/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,284,615	Y4187C	probably damaging	Het
Acot12	A	G	13: 91,784,391	D502G	probably benign	Het
Adrb1	T	C	19: 56,722,688	V106A	probably damaging	Het
Ahcyl2	G	T	6: 29,886,140	G352W	probably damaging	Het
Ahnak2	T	G	12: 112,779,674	D446A		Het
AI481877	T	C	4: 59,076,140	N601S	possibly damaging	Het
Arhgap42	T	C	9: 9,035,531	D270G	probably benign	Het
Atp2a1	A	G	7: 126,459,656	V129A	possibly damaging	Het
B9d2	G	A	7: 25,681,359		probably benign	Het
Bace1	A	T	9: 45,856,139	I207F	possibly damaging	Het
Bmp7	C	T	2: 172,939,964	E36K	possibly damaging	Het
Brsk2	A	G	7: 142,000,860	E654G	probably benign	Het
Cacna2d3	T	C	14: 29,058,421	H661R	probably benign	Het
Cdh4	T	C	2: 179,890,902	V719A	probably benign	Het
Cdkn2d	G	T	9: 21,289,244	P77H	probably damaging	Het
Chd3	A	G	11: 69,356,270	V1024A	probably damaging	Het
Chsy1	T	A	7: 66,171,244	M409K	possibly damaging	Het
Chsy1	T	C	7: 66,171,571	L518P	probably damaging	Het
Cic	G	A	7: 25,272,853	V670M	probably damaging	Het
Clock	A	T	5: 76,242,891		probably null	Het
Coro1a	C	A	7: 126,703,134	V14L	probably damaging	Het
Ctcfl	C	A	2: 173,118,406	C128F	probably damaging	Het
Cyb5b	A	G	8: 107,169,859	T71A	probably damaging	Het
Cyp2c40	C	G	19: 39,807,214	V174L	possibly damaging	Het
D630045J12Rik	T	A	6: 38,196,627	Q202L	possibly damaging	Het
Dgkz	T	C	2: 91,942,815		probably benign	Het
Dlgap2	T	C	8: 14,822,697		probably null	Het
Dnah1	T	C	14: 31,304,983	I695V	probably benign	Het
Dst	T	A	1: 34,182,451	S2445R	possibly damaging	Het
Elob	T	C	17: 23,824,976	D83G	probably benign	Het
Elp4	T	A	2: 105,794,588	D320V	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Etfdh	T	C	3: 79,623,579	Y45C	probably damaging	Het
Exph5	A	G	9: 53,375,773	I1385V	probably benign	Het
Fam104a	C	T	11: 113,663,389	G160D	probably damaging	Het
Fat3	A	T	9: 15,996,842	D2621E	probably damaging	Het
Fbxl6	G	T	15: 76,538,469	A83D	probably benign	Het
Fmo2	A	G	1: 162,888,749	Y90H	probably damaging	Het
Fzd4	T	A	7: 89,407,553	Y269*	probably null	Het
Grik5	T	A	7: 25,058,526	I377F	probably damaging	Het
Havcr2	C	A	11: 46,459,062	P137Q	probably damaging	Het
Hectd4	A	G	5: 121,254,342	N223S	possibly damaging	Het
Hmcn2	A	G	2: 31,457,173	S4792G	probably benign	Het
Hps3	T	G	3: 20,030,452	I191L	probably benign	Het
Ica1l	T	A	1: 60,010,210	K195*	probably null	Het
Idh2	TCCCAGGGCC	TCC	7: 80,098,331		probably null	Het
Ift140	A	G	17: 25,092,341	D1170G	probably benign	Het
Igflr1	T	C	7: 30,567,351	F208S	possibly damaging	Het
Kcnma1	T	C	14: 23,530,242	T313A	probably benign	Het
Krt6a	T	A	15: 101,690,559	I524F	unknown	Het
Lce1d	G	T	3: 92,685,841	H88Q	unknown	Het
Lrmda	A	G	14: 22,828,702	E177G	probably benign	Het
Lrrn3	T	A	12: 41,452,713	N535I	possibly damaging	Het
Map2k4	T	A	11: 65,775,757	I40L	unknown	Het
Map7d1	A	G	4: 126,236,636	L459P	probably damaging	Het
Mipol1	A	T	12: 57,306,073	N66I	possibly damaging	Het
Mycn	A	C	12: 12,940,291	F35V	probably benign	Het
Mzt2	A	C	16: 15,862,805	M40R	possibly damaging	Het
N4bp2	T	G	5: 65,791,115	L363V	probably damaging	Het
Nfat5	T	A	8: 107,370,589	M1532K	probably benign	Het
Notch1	G	A	2: 26,460,165	T2321M	probably benign	Het
Nr1h4	T	C	10: 89,498,261	D89G	probably benign	Het
Nsun4	G	A	4: 116,051,494	T623I	possibly damaging	Het
Nup155	T	C	15: 8,155,047	S1309P	probably benign	Het
Olfr1100	T	C	2: 86,978,778	Y6C	probably benign	Het
Olfr1508	T	C	14: 52,463,394	N205S	probably damaging	Het
Olfr561	T	C	7: 102,781,682	S69P	probably damaging	Het
Pcsk5	A	G	19: 17,836,972	F61L	probably benign	Het
Phrf1	A	T	7: 141,231,225		probably null	Het
Pkd1	G	A	17: 24,573,631	E1431K	probably benign	Het
Pkd2	T	A	5: 104,480,353	I431N	probably damaging	Het
Plcb2	A	G	2: 118,715,643	L557P	probably damaging	Het
Poteg	A	G	8: 27,494,960	N449S	probably benign	Het
Ppargc1b	C	A	18: 61,312,210	G192W	probably damaging	Het
Rab13	T	C	3: 90,224,899	S178P	probably benign	Het
Ralgds	A	G	2: 28,547,595	D571G	probably damaging	Het
Ror2	A	G	13: 53,110,813	S748P	probably benign	Het
Sart1	A	T	19: 5,384,877	L167Q	probably damaging	Het
Sept12	A	G	16: 4,992,191	V160A	possibly damaging	Het
Sgo1	T	C	17: 53,679,267	S299G	probably benign	Het
Slc35b4	T	A	6: 34,163,361	D152V	probably benign	Het
Specc1	T	A	11: 62,128,409		probably null	Het
Synj1	G	A	16: 90,940,483	T1308I	probably benign	Het
Thap12	T	G	7: 98,710,231	L106V	probably damaging	Het
Togaram1	T	C	12: 65,011,142	M1501T	possibly damaging	Het
Top2a	G	T	11: 99,000,837	N1153K	probably benign	Het
Trpm5	A	G	7: 143,080,986	L658P	probably damaging	Het
Ttc21b	G	A	2: 66,217,204	A849V	possibly damaging	Het
Vmn1r80	A	T	7: 12,193,823	I287F	probably damaging	Het
Vmn1r87	T	C	7: 13,131,818	S181G	probably damaging	Het
Vmn2r71	A	T	7: 85,623,907	H643L	probably benign	Het
Washc5	G	A	15: 59,366,192	R228C	probably damaging	Het
Wdr72	T	C	9: 74,210,126	S719P	probably damaging	Het
Xrcc3	G	T	12: 111,807,902	D164E	probably benign	Het
Zc2hc1b	G	A	10: 13,168,785	R45C	probably damaging	Het
Zfp335	A	G	2: 164,895,992	Y900H	probably damaging	Het
Zfp512b	G	A	2: 181,587,082	R697C	probably damaging	Het
Zfp60	T	C	7: 27,749,136	Y410H	probably damaging	Het
Zfp60	T	A	7: 27,749,271	C455S	probably damaging	Het
Zfp605	C	T	5: 110,127,291	Q92*	probably null	Het
Zfp64	C	T	2: 168,925,665	D676N	probably damaging	Het

Other mutations in Blnk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Blnk	APN	19	40934446	missense	probably benign	0.15
IGL01286:Blnk	APN	19	40934506	missense	probably benign	0.00
IGL02090:Blnk	APN	19	40934485	missense	probably benign	0.38
IGL02814:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL02831:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL03024:Blnk	APN	19	40994002	splice site	probably benign
Augen	UTSW	19	40929291	missense	probably damaging	1.00
Blick	UTSW	19	40934459	missense	probably damaging	1.00
busy	UTSW	19	40952391	nonsense	probably null
There	UTSW	19	40952390	missense	possibly damaging	0.94
IGL02988:Blnk	UTSW	19	40929216	missense	probably damaging	1.00
R0140:Blnk	UTSW	19	40940224	missense	probably damaging	0.99
R0671:Blnk	UTSW	19	40937667	nonsense	probably null
R1617:Blnk	UTSW	19	40962363	missense	probably benign
R1638:Blnk	UTSW	19	40937678	missense	probably benign
R1803:Blnk	UTSW	19	40952377	missense	probably damaging	0.96
R1970:Blnk	UTSW	19	40940165	splice site	probably benign
R2880:Blnk	UTSW	19	40962455	missense	probably damaging	1.00
R2980:Blnk	UTSW	19	40962350	missense	probably damaging	1.00
R5421:Blnk	UTSW	19	40968523	missense	probably damaging	1.00
R5987:Blnk	UTSW	19	40929289	missense	possibly damaging	0.95
R6321:Blnk	UTSW	19	40934459	missense	probably damaging	1.00
R6703:Blnk	UTSW	19	40962506	splice site	probably null
R6970:Blnk	UTSW	19	40962377	missense	probably damaging	0.99
R7101:Blnk	UTSW	19	40972638	missense	probably benign	0.01
R7432:Blnk	UTSW	19	40959857	nonsense	probably null
R7797:Blnk	UTSW	19	40959788	missense	possibly damaging	0.51
R8287:Blnk	UTSW	19	40929291	missense	probably damaging	1.00
R8473:Blnk	UTSW	19	40952410	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GCCCAGTGCTTTTATAACCTG -3'
(R):5'- TGCCAAAAGGTACCCCATTG -3'

Sequencing Primer
(F):5'- GCAGGTGCTTCCCTAGTC -3'
(R):5'- CCCCATTGTAAGCAATTTTACAGTG -3'

Posted On

2019-10-17