Incidental Mutation 'R7561:Adcy10'
ID585090
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Nameadenylate cyclase 10
SynonymssAC, Sacy, soluble adenylyl cyclase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7561 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location165485183-165576774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165559172 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1155 (R1155G)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027852
AA Change: R1155G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: R1155G

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111439
AA Change: R1155G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: R1155G

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111440
AA Change: R1155G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: R1155G

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,193,195 N314K probably benign Het
6030419C18Rik A G 9: 58,499,404 D199G probably damaging Het
A430005L14Rik T A 4: 153,960,640 I80N probably benign Het
Abca2 A G 2: 25,446,695 H2271R probably damaging Het
Acad8 T C 9: 26,979,242 I257V probably benign Het
Acot12 A T 13: 91,770,124 T179S probably damaging Het
Adcy9 C T 16: 4,418,164 C461Y probably damaging Het
Adgrf1 G A 17: 43,311,109 V746I possibly damaging Het
Agbl1 C A 7: 76,698,761 Q869K unknown Het
AI837181 T G 19: 5,426,463 V218G probably damaging Het
Alg9 T C 9: 50,842,774 S585P possibly damaging Het
Arhgef38 T C 3: 133,160,728 Q216R Het
Asb4 A T 6: 5,430,968 H401L possibly damaging Het
Atg7 G T 6: 114,673,041 A60S possibly damaging Het
Atp10a T A 7: 58,827,133 C1199S probably damaging Het
Blm G A 7: 80,502,528 A557V probably damaging Het
Cbln1 A T 8: 87,471,996 M82K probably benign Het
Ccdc183 T G 2: 25,611,517 I293L probably benign Het
Col6a3 A G 1: 90,775,741 S3035P unknown Het
Cux2 A T 5: 121,879,868 S206T probably benign Het
Cyfip2 T C 11: 46,270,598 D355G probably benign Het
D430042O09Rik C T 7: 125,842,722 S627L probably benign Het
Dhrs2 A G 14: 55,237,241 H111R probably benign Het
Eif3b T G 5: 140,442,354 D781E probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fermt1 A T 2: 132,916,088 I469N probably benign Het
Fgf20 G T 8: 40,279,934 N154K possibly damaging Het
Fndc10 T A 4: 155,694,871 V124E probably damaging Het
Fra10ac1 T C 19: 38,221,876 D13G probably damaging Het
Gpatch1 A G 7: 35,309,375 S74P probably damaging Het
Gramd1b G A 9: 40,401,615 T19I unknown Het
Grm8 T C 6: 27,429,525 T457A probably benign Het
Gucy2g C A 19: 55,206,340 V882L probably benign Het
Hectd4 G A 5: 121,291,225 R811H possibly damaging Het
Hk1 C T 10: 62,281,028 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il10ra T A 9: 45,255,819 D480V probably benign Het
Il18rap A T 1: 40,524,377 H22L probably benign Het
Inpp5a T A 7: 139,567,422 I321N probably damaging Het
Kat2b T G 17: 53,641,258 L352R probably benign Het
Kcna1 A T 6: 126,642,145 V404E probably damaging Het
Mcm3ap T A 10: 76,492,878 V1110E possibly damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Mpdz A T 4: 81,307,151 N1368K probably damaging Het
Mpzl3 G T 9: 45,055,312 V24F probably benign Het
Mybph G A 1: 134,193,727 probably null Het
Ncam1 G T 9: 49,564,942 D282E probably damaging Het
Ntrk2 G A 13: 58,861,388 C331Y probably benign Het
Nwd2 T A 5: 63,807,091 C1339* probably null Het
Olfr1080 T C 2: 86,553,317 D269G probably benign Het
Olfr1450 T C 19: 12,954,039 V150A probably benign Het
Olfr411 T C 11: 74,347,610 probably benign Het
Osbpl6 C A 2: 76,586,154 T672N probably damaging Het
Pds5b T C 5: 150,739,318 probably null Het
Perm1 A G 4: 156,218,760 N587S probably benign Het
Pex7 A T 10: 19,894,266 C165* probably null Het
Pik3r4 A G 9: 105,687,247 T1347A possibly damaging Het
Pitpnm3 T C 11: 72,051,182 D933G probably benign Het
Rnf213 T A 11: 119,441,719 F2586I Het
Scn10a A G 9: 119,694,324 M1T probably null Het
Sdhaf3 T A 6: 6,956,079 L18Q not run Het
Sept7 A G 9: 25,297,855 E256G possibly damaging Het
Slc35b2 A G 17: 45,566,801 T236A probably damaging Het
Slc4a4 G A 5: 89,199,697 G766R probably damaging Het
Slco6c1 G T 1: 97,072,966 S537Y probably damaging Het
Srp68 T C 11: 116,248,767 E452G probably damaging Het
Taf2 A T 15: 55,055,833 M382K probably benign Het
Tas2r131 A G 6: 132,956,958 L296P probably benign Het
Tlr9 A G 9: 106,225,949 E813G probably benign Het
Trmt44 T C 5: 35,557,992 E659G possibly damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Unc45a G T 7: 80,331,586 S489R possibly damaging Het
Xrn1 T C 9: 95,999,458 V795A probably benign Het
Zbtb22 A T 17: 33,917,978 T366S probably benign Het
Zcchc10 T A 11: 53,324,718 H6Q probably benign Het
Zfp60 A G 7: 27,748,530 K208E probably damaging Het
Zfp780b A T 7: 27,964,612 C173S possibly damaging Het
Zfp786 C A 6: 47,819,733 R757L probably benign Het
Zfp936 G A 7: 43,189,915 A269T probably damaging Het
Zfp976 T C 7: 42,616,277 Y29C probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 intron probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R7988:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTAGGCAGGCATCCGATAAAC -3'
(R):5'- ACTTGTGCTGTGTGGAAGCC -3'

Sequencing Primer
(F):5'- TTTGAAGATGATGTCATAGCACAGG -3'
(R):5'- AAGCCTCTGTTGTCTGGC -3'
Posted On2019-10-17