Mutagenetix > Incidental Mutations

Incidental Mutation 'R7561:Atp10a'

585122

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R7561 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58827133 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1199 (C1199S)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

Predicted Effect

probably damaging
Transcript: ENSMUST00000168747
AA Change: C1199S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: C1199S

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	A	13: 77,193,195	N314K	probably benign	Het
6030419C18Rik	A	G	9: 58,499,404	D199G	probably damaging	Het
A430005L14Rik	T	A	4: 153,960,640	I80N	probably benign	Het
Abca2	A	G	2: 25,446,695	H2271R	probably damaging	Het
Acad8	T	C	9: 26,979,242	I257V	probably benign	Het
Acot12	A	T	13: 91,770,124	T179S	probably damaging	Het
Adcy10	A	G	1: 165,559,172	R1155G	possibly damaging	Het
Adcy9	C	T	16: 4,418,164	C461Y	probably damaging	Het
Adgrf1	G	A	17: 43,311,109	V746I	possibly damaging	Het
Agbl1	C	A	7: 76,698,761	Q869K	unknown	Het
AI837181	T	G	19: 5,426,463	V218G	probably damaging	Het
Alg9	T	C	9: 50,842,774	S585P	possibly damaging	Het
Arhgef38	T	C	3: 133,160,728	Q216R		Het
Asb4	A	T	6: 5,430,968	H401L	possibly damaging	Het
Atg7	G	T	6: 114,673,041	A60S	possibly damaging	Het
Blm	G	A	7: 80,502,528	A557V	probably damaging	Het
Cbln1	A	T	8: 87,471,996	M82K	probably benign	Het
Ccdc183	T	G	2: 25,611,517	I293L	probably benign	Het
Col6a3	A	G	1: 90,775,741	S3035P	unknown	Het
Cux2	A	T	5: 121,879,868	S206T	probably benign	Het
Cyfip2	T	C	11: 46,270,598	D355G	probably benign	Het
D430042O09Rik	C	T	7: 125,842,722	S627L	probably benign	Het
Dhrs2	A	G	14: 55,237,241	H111R	probably benign	Het
Eif3b	T	G	5: 140,442,354	D781E	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fermt1	A	T	2: 132,916,088	I469N	probably benign	Het
Fgf20	G	T	8: 40,279,934	N154K	possibly damaging	Het
Fndc10	T	A	4: 155,694,871	V124E	probably damaging	Het
Fra10ac1	T	C	19: 38,221,876	D13G	probably damaging	Het
Gpatch1	A	G	7: 35,309,375	S74P	probably damaging	Het
Gramd1b	G	A	9: 40,401,615	T19I	unknown	Het
Grm8	T	C	6: 27,429,525	T457A	probably benign	Het
Gucy2g	C	A	19: 55,206,340	V882L	probably benign	Het
Hectd4	G	A	5: 121,291,225	R811H	possibly damaging	Het
Hk1	C	T	10: 62,281,028		probably null	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Il10ra	T	A	9: 45,255,819	D480V	probably benign	Het
Il18rap	A	T	1: 40,524,377	H22L	probably benign	Het
Inpp5a	T	A	7: 139,567,422	I321N	probably damaging	Het
Kat2b	T	G	17: 53,641,258	L352R	probably benign	Het
Kcna1	A	T	6: 126,642,145	V404E	probably damaging	Het
Mcm3ap	T	A	10: 76,492,878	V1110E	possibly damaging	Het
Moxd2	C	T	6: 40,887,403	R31H	probably damaging	Het
Mpdz	A	T	4: 81,307,151	N1368K	probably damaging	Het
Mpzl3	G	T	9: 45,055,312	V24F	probably benign	Het
Mybph	G	A	1: 134,193,727		probably null	Het
Ncam1	G	T	9: 49,564,942	D282E	probably damaging	Het
Ntrk2	G	A	13: 58,861,388	C331Y	probably benign	Het
Nwd2	T	A	5: 63,807,091	C1339*	probably null	Het
Olfr1080	T	C	2: 86,553,317	D269G	probably benign	Het
Olfr1450	T	C	19: 12,954,039	V150A	probably benign	Het
Olfr411	T	C	11: 74,347,610		probably benign	Het
Osbpl6	C	A	2: 76,586,154	T672N	probably damaging	Het
Pds5b	T	C	5: 150,739,318		probably null	Het
Perm1	A	G	4: 156,218,760	N587S	probably benign	Het
Pex7	A	T	10: 19,894,266	C165*	probably null	Het
Pik3r4	A	G	9: 105,687,247	T1347A	possibly damaging	Het
Pitpnm3	T	C	11: 72,051,182	D933G	probably benign	Het
Rnf213	T	A	11: 119,441,719	F2586I		Het
Scn10a	A	G	9: 119,694,324	M1T	probably null	Het
Sdhaf3	T	A	6: 6,956,079	L18Q	not run	Het
Sept7	A	G	9: 25,297,855	E256G	possibly damaging	Het
Slc35b2	A	G	17: 45,566,801	T236A	probably damaging	Het
Slc4a4	G	A	5: 89,199,697	G766R	probably damaging	Het
Slco6c1	G	T	1: 97,072,966	S537Y	probably damaging	Het
Srp68	T	C	11: 116,248,767	E452G	probably damaging	Het
Taf2	A	T	15: 55,055,833	M382K	probably benign	Het
Tas2r131	A	G	6: 132,956,958	L296P	probably benign	Het
Tlr9	A	G	9: 106,225,949	E813G	probably benign	Het
Trmt44	T	C	5: 35,557,992	E659G	possibly damaging	Het
Ttc21b	G	A	2: 66,217,204	A849V	possibly damaging	Het
Unc45a	G	T	7: 80,331,586	S489R	possibly damaging	Het
Xrn1	T	C	9: 95,999,458	V795A	probably benign	Het
Zbtb22	A	T	17: 33,917,978	T366S	probably benign	Het
Zcchc10	T	A	11: 53,324,718	H6Q	probably benign	Het
Zfp60	A	G	7: 27,748,530	K208E	probably damaging	Het
Zfp780b	A	T	7: 27,964,612	C173S	possibly damaging	Het
Zfp786	C	A	6: 47,819,733	R757L	probably benign	Het
Zfp936	G	A	7: 43,189,915	A269T	probably damaging	Het
Zfp976	T	C	7: 42,616,277	Y29C	probably damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGGCTCCTGAAACAAAACATTG -3'
(R):5'- TGGCTCTCACCCAGGTTTTG -3'

Sequencing Primer
(F):5'- ACAAAACATTGTCTTCCAGGCCTTG -3'
(R):5'- GTTTCAATACCCAGGTGCAGCAG -3'

Posted On

2019-10-17