Incidental Mutation 'R7561:Ncam1'
ID585136
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R7561 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 49564942 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 282 (D282E)
Ref Sequence ENSEMBL: ENSMUSP00000142275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000192584] [ENSMUST00000193547]
Predicted Effect probably damaging
Transcript: ENSMUST00000114476
AA Change: D282E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542
AA Change: D282E

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
low complexity region 711 725 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542
AA Change: D282E

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192584
AA Change: D282E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141700
Gene: ENSMUSG00000039542
AA Change: D282E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 1.2e-6 SMART
IGc2 130 196 2.6e-8 SMART
IGc2 226 295 2.6e-22 SMART
IGc2 321 393 1.6e-16 SMART
IGc2 418 487 4e-13 SMART
FN3 501 586 2.4e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193547
AA Change: D282E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542
AA Change: D282E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,193,195 N314K probably benign Het
6030419C18Rik A G 9: 58,499,404 D199G probably damaging Het
A430005L14Rik T A 4: 153,960,640 I80N probably benign Het
Abca2 A G 2: 25,446,695 H2271R probably damaging Het
Acad8 T C 9: 26,979,242 I257V probably benign Het
Acot12 A T 13: 91,770,124 T179S probably damaging Het
Adcy10 A G 1: 165,559,172 R1155G possibly damaging Het
Adcy9 C T 16: 4,418,164 C461Y probably damaging Het
Adgrf1 G A 17: 43,311,109 V746I possibly damaging Het
Agbl1 C A 7: 76,698,761 Q869K unknown Het
AI837181 T G 19: 5,426,463 V218G probably damaging Het
Alg9 T C 9: 50,842,774 S585P possibly damaging Het
Arhgef38 T C 3: 133,160,728 Q216R Het
Asb4 A T 6: 5,430,968 H401L possibly damaging Het
Atg7 G T 6: 114,673,041 A60S possibly damaging Het
Atp10a T A 7: 58,827,133 C1199S probably damaging Het
Blm G A 7: 80,502,528 A557V probably damaging Het
Cbln1 A T 8: 87,471,996 M82K probably benign Het
Ccdc183 T G 2: 25,611,517 I293L probably benign Het
Col6a3 A G 1: 90,775,741 S3035P unknown Het
Cux2 A T 5: 121,879,868 S206T probably benign Het
Cyfip2 T C 11: 46,270,598 D355G probably benign Het
D430042O09Rik C T 7: 125,842,722 S627L probably benign Het
Dhrs2 A G 14: 55,237,241 H111R probably benign Het
Eif3b T G 5: 140,442,354 D781E probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fermt1 A T 2: 132,916,088 I469N probably benign Het
Fgf20 G T 8: 40,279,934 N154K possibly damaging Het
Fndc10 T A 4: 155,694,871 V124E probably damaging Het
Fra10ac1 T C 19: 38,221,876 D13G probably damaging Het
Gpatch1 A G 7: 35,309,375 S74P probably damaging Het
Gramd1b G A 9: 40,401,615 T19I unknown Het
Grm8 T C 6: 27,429,525 T457A probably benign Het
Gucy2g C A 19: 55,206,340 V882L probably benign Het
Hectd4 G A 5: 121,291,225 R811H possibly damaging Het
Hk1 C T 10: 62,281,028 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il10ra T A 9: 45,255,819 D480V probably benign Het
Il18rap A T 1: 40,524,377 H22L probably benign Het
Inpp5a T A 7: 139,567,422 I321N probably damaging Het
Kat2b T G 17: 53,641,258 L352R probably benign Het
Kcna1 A T 6: 126,642,145 V404E probably damaging Het
Mcm3ap T A 10: 76,492,878 V1110E possibly damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Mpdz A T 4: 81,307,151 N1368K probably damaging Het
Mpzl3 G T 9: 45,055,312 V24F probably benign Het
Mybph G A 1: 134,193,727 probably null Het
Ntrk2 G A 13: 58,861,388 C331Y probably benign Het
Nwd2 T A 5: 63,807,091 C1339* probably null Het
Olfr1080 T C 2: 86,553,317 D269G probably benign Het
Olfr1450 T C 19: 12,954,039 V150A probably benign Het
Olfr411 T C 11: 74,347,610 probably benign Het
Osbpl6 C A 2: 76,586,154 T672N probably damaging Het
Pds5b T C 5: 150,739,318 probably null Het
Perm1 A G 4: 156,218,760 N587S probably benign Het
Pex7 A T 10: 19,894,266 C165* probably null Het
Pik3r4 A G 9: 105,687,247 T1347A possibly damaging Het
Pitpnm3 T C 11: 72,051,182 D933G probably benign Het
Rnf213 T A 11: 119,441,719 F2586I Het
Scn10a A G 9: 119,694,324 M1T probably null Het
Sdhaf3 T A 6: 6,956,079 L18Q not run Het
Sept7 A G 9: 25,297,855 E256G possibly damaging Het
Slc35b2 A G 17: 45,566,801 T236A probably damaging Het
Slc4a4 G A 5: 89,199,697 G766R probably damaging Het
Slco6c1 G T 1: 97,072,966 S537Y probably damaging Het
Srp68 T C 11: 116,248,767 E452G probably damaging Het
Taf2 A T 15: 55,055,833 M382K probably benign Het
Tas2r131 A G 6: 132,956,958 L296P probably benign Het
Tlr9 A G 9: 106,225,949 E813G probably benign Het
Trmt44 T C 5: 35,557,992 E659G possibly damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Unc45a G T 7: 80,331,586 S489R possibly damaging Het
Xrn1 T C 9: 95,999,458 V795A probably benign Het
Zbtb22 A T 17: 33,917,978 T366S probably benign Het
Zcchc10 T A 11: 53,324,718 H6Q probably benign Het
Zfp60 A G 7: 27,748,530 K208E probably damaging Het
Zfp780b A T 7: 27,964,612 C173S possibly damaging Het
Zfp786 C A 6: 47,819,733 R757L probably benign Het
Zfp936 G A 7: 43,189,915 A269T probably damaging Het
Zfp976 T C 7: 42,616,277 Y29C probably damaging Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
R7645:Ncam1 UTSW 9 49565003 missense probably benign 0.01
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGTGTCAGAGCAGGCAG -3'
(R):5'- CTTCGCACAGTGGGAAATGATC -3'

Sequencing Primer
(F):5'- TCATGGATGCATGCCATGAC -3'
(R):5'- GGAAATGATCAGAAATGAACCTCTTC -3'
Posted On2019-10-17