Incidental Mutation 'R7561:Scn10a'
ID585142
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7561 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119608456-119719322 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 119694324 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000148987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect probably null
Transcript: ENSMUST00000084787
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: M1T

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213392
AA Change: M1T

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably null
Transcript: ENSMUST00000214408
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,193,195 N314K probably benign Het
6030419C18Rik A G 9: 58,499,404 D199G probably damaging Het
A430005L14Rik T A 4: 153,960,640 I80N probably benign Het
Abca2 A G 2: 25,446,695 H2271R probably damaging Het
Acad8 T C 9: 26,979,242 I257V probably benign Het
Acot12 A T 13: 91,770,124 T179S probably damaging Het
Adcy10 A G 1: 165,559,172 R1155G possibly damaging Het
Adcy9 C T 16: 4,418,164 C461Y probably damaging Het
Adgrf1 G A 17: 43,311,109 V746I possibly damaging Het
Agbl1 C A 7: 76,698,761 Q869K unknown Het
AI837181 T G 19: 5,426,463 V218G probably damaging Het
Alg9 T C 9: 50,842,774 S585P possibly damaging Het
Arhgef38 T C 3: 133,160,728 Q216R Het
Asb4 A T 6: 5,430,968 H401L possibly damaging Het
Atg7 G T 6: 114,673,041 A60S possibly damaging Het
Atp10a T A 7: 58,827,133 C1199S probably damaging Het
Blm G A 7: 80,502,528 A557V probably damaging Het
Cbln1 A T 8: 87,471,996 M82K probably benign Het
Ccdc183 T G 2: 25,611,517 I293L probably benign Het
Col6a3 A G 1: 90,775,741 S3035P unknown Het
Cux2 A T 5: 121,879,868 S206T probably benign Het
Cyfip2 T C 11: 46,270,598 D355G probably benign Het
D430042O09Rik C T 7: 125,842,722 S627L probably benign Het
Dhrs2 A G 14: 55,237,241 H111R probably benign Het
Eif3b T G 5: 140,442,354 D781E probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fermt1 A T 2: 132,916,088 I469N probably benign Het
Fgf20 G T 8: 40,279,934 N154K possibly damaging Het
Fndc10 T A 4: 155,694,871 V124E probably damaging Het
Fra10ac1 T C 19: 38,221,876 D13G probably damaging Het
Gpatch1 A G 7: 35,309,375 S74P probably damaging Het
Gramd1b G A 9: 40,401,615 T19I unknown Het
Grm8 T C 6: 27,429,525 T457A probably benign Het
Gucy2g C A 19: 55,206,340 V882L probably benign Het
Hectd4 G A 5: 121,291,225 R811H possibly damaging Het
Hk1 C T 10: 62,281,028 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il10ra T A 9: 45,255,819 D480V probably benign Het
Il18rap A T 1: 40,524,377 H22L probably benign Het
Inpp5a T A 7: 139,567,422 I321N probably damaging Het
Kat2b T G 17: 53,641,258 L352R probably benign Het
Kcna1 A T 6: 126,642,145 V404E probably damaging Het
Mcm3ap T A 10: 76,492,878 V1110E possibly damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Mpdz A T 4: 81,307,151 N1368K probably damaging Het
Mpzl3 G T 9: 45,055,312 V24F probably benign Het
Mybph G A 1: 134,193,727 probably null Het
Ncam1 G T 9: 49,564,942 D282E probably damaging Het
Ntrk2 G A 13: 58,861,388 C331Y probably benign Het
Nwd2 T A 5: 63,807,091 C1339* probably null Het
Olfr1080 T C 2: 86,553,317 D269G probably benign Het
Olfr1450 T C 19: 12,954,039 V150A probably benign Het
Olfr411 T C 11: 74,347,610 probably benign Het
Osbpl6 C A 2: 76,586,154 T672N probably damaging Het
Pds5b T C 5: 150,739,318 probably null Het
Perm1 A G 4: 156,218,760 N587S probably benign Het
Pex7 A T 10: 19,894,266 C165* probably null Het
Pik3r4 A G 9: 105,687,247 T1347A possibly damaging Het
Pitpnm3 T C 11: 72,051,182 D933G probably benign Het
Rnf213 T A 11: 119,441,719 F2586I Het
Sdhaf3 T A 6: 6,956,079 L18Q not run Het
Sept7 A G 9: 25,297,855 E256G possibly damaging Het
Slc35b2 A G 17: 45,566,801 T236A probably damaging Het
Slc4a4 G A 5: 89,199,697 G766R probably damaging Het
Slco6c1 G T 1: 97,072,966 S537Y probably damaging Het
Srp68 T C 11: 116,248,767 E452G probably damaging Het
Taf2 A T 15: 55,055,833 M382K probably benign Het
Tas2r131 A G 6: 132,956,958 L296P probably benign Het
Tlr9 A G 9: 106,225,949 E813G probably benign Het
Trmt44 T C 5: 35,557,992 E659G possibly damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Unc45a G T 7: 80,331,586 S489R possibly damaging Het
Xrn1 T C 9: 95,999,458 V795A probably benign Het
Zbtb22 A T 17: 33,917,978 T366S probably benign Het
Zcchc10 T A 11: 53,324,718 H6Q probably benign Het
Zfp60 A G 7: 27,748,530 K208E probably damaging Het
Zfp780b A T 7: 27,964,612 C173S possibly damaging Het
Zfp786 C A 6: 47,819,733 R757L probably benign Het
Zfp936 G A 7: 43,189,915 A269T probably damaging Het
Zfp976 T C 7: 42,616,277 Y29C probably damaging Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 missense probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 missense probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 missense probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 splice site probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense probably benign 0.01
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2013:Scn10a UTSW 9 119613736 missense probably damaging 0.99
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
R6877:Scn10a UTSW 9 119609782 missense probably damaging 0.96
R6909:Scn10a UTSW 9 119609790 missense probably damaging 1.00
R7023:Scn10a UTSW 9 119613544 missense probably damaging 0.99
R7205:Scn10a UTSW 9 119613550 missense probably damaging 0.99
R7254:Scn10a UTSW 9 119618855 missense probably damaging 0.99
R7261:Scn10a UTSW 9 119609724 missense probably damaging 0.97
R7283:Scn10a UTSW 9 119664779 critical splice donor site probably null
R7453:Scn10a UTSW 9 119638552 missense probably benign
R7590:Scn10a UTSW 9 119666400 missense probably damaging 1.00
R7759:Scn10a UTSW 9 119648132 nonsense probably null
R7765:Scn10a UTSW 9 119609904 missense possibly damaging 0.90
R7851:Scn10a UTSW 9 119617762 missense probably damaging 0.99
R7875:Scn10a UTSW 9 119635442 critical splice donor site probably null
R7975:Scn10a UTSW 9 119672220 missense probably benign 0.31
R8010:Scn10a UTSW 9 119661167 missense possibly damaging 0.56
R8027:Scn10a UTSW 9 119633790 missense probably damaging 0.99
R8221:Scn10a UTSW 9 119617763 missense probably damaging 1.00
R8249:Scn10a UTSW 9 119617774 missense probably damaging 1.00
R8319:Scn10a UTSW 9 119670389 missense probably benign 0.04
R8323:Scn10a UTSW 9 119609396 missense possibly damaging 0.95
R8539:Scn10a UTSW 9 119638774 nonsense probably null
R8679:Scn10a UTSW 9 119672128 missense probably damaging 0.97
R8680:Scn10a UTSW 9 119691443 critical splice donor site probably null
R8844:Scn10a UTSW 9 119617725 missense probably damaging 0.98
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Z1177:Scn10a UTSW 9 119624145 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCCTTCAAGTCCAACTGAG -3'
(R):5'- ATATGGAGCAAAGACACACCTG -3'

Sequencing Primer
(F):5'- TTCAAGTCCAACTGAGGCCTG -3'
(R):5'- CAATCAAGTAGGGGTGATGG -3'
Posted On2019-10-17