Incidental Mutation 'R7561:Slc35b2'
ID585160
Institutional Source Beutler Lab
Gene Symbol Slc35b2
Ensembl Gene ENSMUSG00000037089
Gene Namesolute carrier family 35, member B2
SynonymsPAPST1, 1110003M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7561 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location45563874-45567671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45566801 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000037834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000024742] [ENSMUST00000041353] [ENSMUST00000130406] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905] [ENSMUST00000226086]
Predicted Effect probably benign
Transcript: ENSMUST00000024739
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024742
SMART Domains Protein: ENSMUSP00000024742
Gene: ENSMUSG00000023947

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
ANK 122 152 1.14e2 SMART
ANK 157 187 2.15e0 SMART
ANK 190 219 6.81e-3 SMART
ANK 233 262 5.09e-2 SMART
ANK 267 296 1.12e-3 SMART
ANK 300 329 1e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041353
AA Change: T236A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089
AA Change: T236A

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130406
SMART Domains Protein: ENSMUSP00000119678
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 76 2e-32 SMART
PDB:1UYM|A 14 76 7e-38 PDB
Blast:HATPase_c 35 76 3e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163966
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223987
AA Change: T236A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224341
Predicted Effect probably damaging
Transcript: ENSMUST00000224905
AA Change: T285A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226086
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,193,195 N314K probably benign Het
6030419C18Rik A G 9: 58,499,404 D199G probably damaging Het
A430005L14Rik T A 4: 153,960,640 I80N probably benign Het
Abca2 A G 2: 25,446,695 H2271R probably damaging Het
Acad8 T C 9: 26,979,242 I257V probably benign Het
Acot12 A T 13: 91,770,124 T179S probably damaging Het
Adcy10 A G 1: 165,559,172 R1155G possibly damaging Het
Adcy9 C T 16: 4,418,164 C461Y probably damaging Het
Adgrf1 G A 17: 43,311,109 V746I possibly damaging Het
Agbl1 C A 7: 76,698,761 Q869K unknown Het
AI837181 T G 19: 5,426,463 V218G probably damaging Het
Alg9 T C 9: 50,842,774 S585P possibly damaging Het
Arhgef38 T C 3: 133,160,728 Q216R Het
Asb4 A T 6: 5,430,968 H401L possibly damaging Het
Atg7 G T 6: 114,673,041 A60S possibly damaging Het
Atp10a T A 7: 58,827,133 C1199S probably damaging Het
Blm G A 7: 80,502,528 A557V probably damaging Het
Cbln1 A T 8: 87,471,996 M82K probably benign Het
Ccdc183 T G 2: 25,611,517 I293L probably benign Het
Col6a3 A G 1: 90,775,741 S3035P unknown Het
Cux2 A T 5: 121,879,868 S206T probably benign Het
Cyfip2 T C 11: 46,270,598 D355G probably benign Het
D430042O09Rik C T 7: 125,842,722 S627L probably benign Het
Dhrs2 A G 14: 55,237,241 H111R probably benign Het
Eif3b T G 5: 140,442,354 D781E probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fermt1 A T 2: 132,916,088 I469N probably benign Het
Fgf20 G T 8: 40,279,934 N154K possibly damaging Het
Fndc10 T A 4: 155,694,871 V124E probably damaging Het
Fra10ac1 T C 19: 38,221,876 D13G probably damaging Het
Gpatch1 A G 7: 35,309,375 S74P probably damaging Het
Gramd1b G A 9: 40,401,615 T19I unknown Het
Grm8 T C 6: 27,429,525 T457A probably benign Het
Gucy2g C A 19: 55,206,340 V882L probably benign Het
Hectd4 G A 5: 121,291,225 R811H possibly damaging Het
Hk1 C T 10: 62,281,028 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il10ra T A 9: 45,255,819 D480V probably benign Het
Il18rap A T 1: 40,524,377 H22L probably benign Het
Inpp5a T A 7: 139,567,422 I321N probably damaging Het
Kat2b T G 17: 53,641,258 L352R probably benign Het
Kcna1 A T 6: 126,642,145 V404E probably damaging Het
Mcm3ap T A 10: 76,492,878 V1110E possibly damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Mpdz A T 4: 81,307,151 N1368K probably damaging Het
Mpzl3 G T 9: 45,055,312 V24F probably benign Het
Mybph G A 1: 134,193,727 probably null Het
Ncam1 G T 9: 49,564,942 D282E probably damaging Het
Ntrk2 G A 13: 58,861,388 C331Y probably benign Het
Nwd2 T A 5: 63,807,091 C1339* probably null Het
Olfr1080 T C 2: 86,553,317 D269G probably benign Het
Olfr1450 T C 19: 12,954,039 V150A probably benign Het
Olfr411 T C 11: 74,347,610 probably benign Het
Osbpl6 C A 2: 76,586,154 T672N probably damaging Het
Pds5b T C 5: 150,739,318 probably null Het
Perm1 A G 4: 156,218,760 N587S probably benign Het
Pex7 A T 10: 19,894,266 C165* probably null Het
Pik3r4 A G 9: 105,687,247 T1347A possibly damaging Het
Pitpnm3 T C 11: 72,051,182 D933G probably benign Het
Rnf213 T A 11: 119,441,719 F2586I Het
Scn10a A G 9: 119,694,324 M1T probably null Het
Sdhaf3 T A 6: 6,956,079 L18Q not run Het
Sept7 A G 9: 25,297,855 E256G possibly damaging Het
Slc4a4 G A 5: 89,199,697 G766R probably damaging Het
Slco6c1 G T 1: 97,072,966 S537Y probably damaging Het
Srp68 T C 11: 116,248,767 E452G probably damaging Het
Taf2 A T 15: 55,055,833 M382K probably benign Het
Tas2r131 A G 6: 132,956,958 L296P probably benign Het
Tlr9 A G 9: 106,225,949 E813G probably benign Het
Trmt44 T C 5: 35,557,992 E659G possibly damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Unc45a G T 7: 80,331,586 S489R possibly damaging Het
Xrn1 T C 9: 95,999,458 V795A probably benign Het
Zbtb22 A T 17: 33,917,978 T366S probably benign Het
Zcchc10 T A 11: 53,324,718 H6Q probably benign Het
Zfp60 A G 7: 27,748,530 K208E probably damaging Het
Zfp780b A T 7: 27,964,612 C173S possibly damaging Het
Zfp786 C A 6: 47,819,733 R757L probably benign Het
Zfp936 G A 7: 43,189,915 A269T probably damaging Het
Zfp976 T C 7: 42,616,277 Y29C probably damaging Het
Other mutations in Slc35b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Slc35b2 APN 17 45564960 missense probably damaging 0.99
IGL02749:Slc35b2 APN 17 45566567 missense probably benign 0.14
IGL02951:Slc35b2 APN 17 45564768 missense probably damaging 1.00
IGL03382:Slc35b2 APN 17 45566645 missense probably damaging 0.98
R0020:Slc35b2 UTSW 17 45566856 missense probably damaging 1.00
R0368:Slc35b2 UTSW 17 45566463 missense probably benign
R0743:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R0884:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R2293:Slc35b2 UTSW 17 45567141 missense probably damaging 1.00
R3894:Slc35b2 UTSW 17 45566442 missense probably benign 0.01
R4372:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4415:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4416:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4417:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R5291:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5314:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5929:Slc35b2 UTSW 17 45566661 missense probably benign 0.35
R6178:Slc35b2 UTSW 17 45566376 missense probably benign 0.10
R7217:Slc35b2 UTSW 17 45565029 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGATGGGAAAGCTGGTGTCC -3'
(R):5'- TGTAGAAGATGAAGAGCTGCCC -3'

Sequencing Primer
(F):5'- CTTCTATCCAGTGGACCA -3'
(R):5'- TGAAGAGCTGCCCAAAGG -3'
Posted On2019-10-17