Mutagenetix > Incidental Mutations

Incidental Mutation 'R7562:Speg'

585166

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7562 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75431279 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 3206 (D3206G)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037796] [ENSMUST00000087122] [ENSMUST00000113584] [ENSMUST00000131545] [ENSMUST00000133418] [ENSMUST00000140287] [ENSMUST00000141124] [ENSMUST00000143730] [ENSMUST00000144874] [ENSMUST00000145166]

Predicted Effect

probably benign
Transcript: ENSMUST00000037796

SMART Domains

Protein: ENSMUSP00000035564
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	209	1.2e-30	PFAM
Pfam:NTP_transf_3	4	206	4.1e-10	PFAM
Pfam:Hexapep	280	321	2.6e-8	PFAM
low complexity region	357	365	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000087122
AA Change: D3206G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: D3206G

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113584

SMART Domains

Protein: ENSMUSP00000109214
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	209	1.6e-28	PFAM
Pfam:NTP_transf_3	4	206	1.6e-9	PFAM
Pfam:Hexapep	286	321	4.3e-8	PFAM
low complexity region	357	365	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131545

SMART Domains

Protein: ENSMUSP00000120841
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	209	7.2e-31	PFAM
Pfam:NTP_transf_3	4	157	1.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133418

SMART Domains

Protein: ENSMUSP00000122443
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	209	6.8e-31	PFAM
Pfam:NTP_transf_3	4	204	1e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140287

SMART Domains

Protein: ENSMUSP00000121552
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	161	1.7e-22	PFAM
Pfam:NTP_transf_3	4	155	6.1e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141124

SMART Domains

Protein: ENSMUSP00000116783
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	72	1.1e-13	PFAM
Pfam:NTP_transf_3	4	71	1.9e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143679

Predicted Effect

probably benign
Transcript: ENSMUST00000143730

SMART Domains

Protein: ENSMUSP00000114375
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	196	1.1e-30	PFAM
Pfam:NTP_transf_3	4	173	9.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144874

SMART Domains

Protein: ENSMUSP00000121418
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	1	174	6.6e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145166

SMART Domains

Protein: ENSMUSP00000116754
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	91	5.2e-15	PFAM
Pfam:NTP_transf_3	4	88	1.4e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	C	A	1: 93,159,967	V55F	probably damaging	Het
4930539E08Rik	T	C	17: 28,909,804	D45G	probably benign	Het
5430419D17Rik	T	A	7: 131,302,697	D2381E	unknown	Het
Ablim2	C	T	5: 35,873,219	T544M	probably benign	Het
Adamts12	A	G	15: 11,270,611	R651G	probably benign	Het
Adck1	G	A	12: 88,368,433	D30N	possibly damaging	Het
Alcam	T	A	16: 52,268,823	I505F	probably benign	Het
Alms1	T	C	6: 85,620,412	L740P	probably damaging	Het
Ankib1	C	T	5: 3,747,021	D264N	probably null	Het
Arid2	T	G	15: 96,401,968	H1787Q	probably damaging	Het
Asf1a	C	T	10: 53,606,187	R102*	probably null	Het
Atp2b1	C	A	10: 99,022,805		probably null	Het
Bdp1	T	C	13: 100,025,541	D2291G	probably benign	Het
Brinp3	C	G	1: 146,902,010	L732V	possibly damaging	Het
Catsperg2	A	G	7: 29,697,719	F1120L	probably benign	Het
Ccdc80	C	T	16: 45,122,903	A792V	probably damaging	Het
Cenpe	C	T	3: 135,248,634	R1751W	probably damaging	Het
Cenpm	T	C	15: 82,241,361	I66V	probably benign	Het
Clcn4	A	G	7: 7,295,082	W103R	possibly damaging	Het
Cntn2	T	C	1: 132,526,317	D317G	possibly damaging	Het
Cwf19l1	G	A	19: 44,129,241	T154M	probably damaging	Het
Cyp2a4	T	A	7: 26,312,896	M368K	possibly damaging	Het
Dars	A	G	1: 128,367,026	S413P	possibly damaging	Het
Dscc1	A	G	15: 55,084,185	Y200H	probably benign	Het
Dsn1	A	T	2: 157,000,872	D183E	probably damaging	Het
Etfdh	T	C	3: 79,623,579	Y45C	probably damaging	Het
Fam71f1	T	C	6: 29,323,834	V186A	probably damaging	Het
Fancc	A	T	13: 63,403,053		probably null	Het
Fbxo34	T	A	14: 47,529,678	M216K	probably benign	Het
Fer1l6	T	G	15: 58,560,482	S293A	probably benign	Het
Foxn1	T	A	11: 78,371,132	E137V	probably damaging	Het
Fshr	A	C	17: 88,988,497	F261V	probably damaging	Het
Gabrb3	C	T	7: 57,812,178	R153*	probably null	Het
Gps2	C	A	11: 69,916,482	N321K	probably benign	Het
Hdgf	T	C	3: 87,906,686	M20T	possibly damaging	Het
Igdcc4	G	T	9: 65,124,024	A415S	probably damaging	Het
Kif26b	A	G	1: 178,914,976	E879G	probably damaging	Het
Krt13	T	C	11: 100,119,336	Y273C	probably damaging	Het
Mag	A	G	7: 30,909,134	V185A	possibly damaging	Het
Map3k21	C	T	8: 125,938,800	T576M	probably damaging	Het
Mtrr	A	G	13: 68,566,217	F468L	probably damaging	Het
Myb	C	T	10: 21,141,754		probably null	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nckap5l	A	T	15: 99,423,285		probably null	Het
Nop9	C	T	14: 55,749,352	R240W	probably benign	Het
Notch2	T	C	3: 98,113,114	L775P	probably damaging	Het
Olfr1221	C	T	2: 89,112,285	V76I	probably benign	Het
Olfr19	T	C	16: 16,673,715	N89D	probably benign	Het
Olfr25	A	G	9: 38,329,943	T116A	probably damaging	Het
Olfr545	T	A	7: 102,494,020	I252F	possibly damaging	Het
Olfr60	T	C	7: 140,345,230	Y253C	probably damaging	Het
Oxa1l	T	A	14: 54,363,477	W136R	probably damaging	Het
Palm3	T	A	8: 84,021,507	V7E	possibly damaging	Het
Pkhd1l1	C	G	15: 44,514,930	R1027G	possibly damaging	Het
Prickle2	A	T	6: 92,375,948	*902K	probably null	Het
Rassf7	C	T	7: 141,217,188	R105*	probably null	Het
Sept9	T	C	11: 117,326,511		probably null	Het
Soga1	A	C	2: 157,053,589	L332R	probably damaging	Het
Sorbs3	T	C	14: 70,207,527	N34S	probably benign	Het
Sos2	T	C	12: 69,635,638	T269A	probably benign	Het
Spata20	T	G	11: 94,482,553	K497N	probably benign	Het
Tenm4	A	G	7: 96,888,814	T1865A	probably damaging	Het
Tmc5	A	T	7: 118,623,326	Y83F	probably benign	Het
Tmem175	T	A	5: 108,641,849	D103E	probably damaging	Het
Top2b	A	C	14: 16,412,946	M952L	probably benign	Het
Vmn2r6	T	C	3: 64,556,520	I298V	probably benign	Het
Vmn2r69	T	C	7: 85,407,212	I573V	probably benign	Het
Vmn2r93	A	G	17: 18,298,469	I63M	probably benign	Het
Zfp568	G	A	7: 30,023,256	R542H	probably benign	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAGTCAGTCCCTATTGCAGAG -3'
(R):5'- TCTGGAATGTCCCTTGGCAG -3'

Sequencing Primer
(F):5'- TCCCTATTGCAGAGACTGGGAATC -3'
(R):5'- GAACCCAAGTTGAAGCCCGTG -3'

Posted On

2019-10-17