Mutagenetix > Incidental Mutations

Incidental Mutation 'R7562:Dars'

585168

Institutional Source

Beutler Lab

Gene Symbol

Dars

Ensembl Gene

ENSMUSG00000026356

Gene Name

aspartyl-tRNA synthetase

Synonyms

5730439G15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R7562 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128363707-128417368 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128367026 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 413 (S413P)

Ref Sequence

ENSEMBL: ENSMUSP00000027602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027602]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027602
AA Change: S413P

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027602
Gene: ENSMUSG00000026356
AA Change: S413P

Domain	Start	End	E-Value	Type
Pfam:tRNA_anti-codon	60	145	4.6e-10	PFAM
Pfam:tRNA-synt_2	175	496	2.3e-77	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele die between E11 and E14. Mice heterozygous for the allele exhibit decreased PPI. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	C	A	1: 93,159,967	V55F	probably damaging	Het
4930539E08Rik	T	C	17: 28,909,804	D45G	probably benign	Het
5430419D17Rik	T	A	7: 131,302,697	D2381E	unknown	Het
Ablim2	C	T	5: 35,873,219	T544M	probably benign	Het
Adamts12	A	G	15: 11,270,611	R651G	probably benign	Het
Adck1	G	A	12: 88,368,433	D30N	possibly damaging	Het
Alcam	T	A	16: 52,268,823	I505F	probably benign	Het
Alms1	T	C	6: 85,620,412	L740P	probably damaging	Het
Ankib1	C	T	5: 3,747,021	D264N	probably null	Het
Arid2	T	G	15: 96,401,968	H1787Q	probably damaging	Het
Asf1a	C	T	10: 53,606,187	R102*	probably null	Het
Atp2b1	C	A	10: 99,022,805		probably null	Het
Bdp1	T	C	13: 100,025,541	D2291G	probably benign	Het
Brinp3	C	G	1: 146,902,010	L732V	possibly damaging	Het
Catsperg2	A	G	7: 29,697,719	F1120L	probably benign	Het
Ccdc80	C	T	16: 45,122,903	A792V	probably damaging	Het
Cenpe	C	T	3: 135,248,634	R1751W	probably damaging	Het
Cenpm	T	C	15: 82,241,361	I66V	probably benign	Het
Clcn4	A	G	7: 7,295,082	W103R	possibly damaging	Het
Cntn2	T	C	1: 132,526,317	D317G	possibly damaging	Het
Cwf19l1	G	A	19: 44,129,241	T154M	probably damaging	Het
Cyp2a4	T	A	7: 26,312,896	M368K	possibly damaging	Het
Dscc1	A	G	15: 55,084,185	Y200H	probably benign	Het
Dsn1	A	T	2: 157,000,872	D183E	probably damaging	Het
Etfdh	T	C	3: 79,623,579	Y45C	probably damaging	Het
Fam71f1	T	C	6: 29,323,834	V186A	probably damaging	Het
Fancc	A	T	13: 63,403,053		probably null	Het
Fbxo34	T	A	14: 47,529,678	M216K	probably benign	Het
Fer1l6	T	G	15: 58,560,482	S293A	probably benign	Het
Foxn1	T	A	11: 78,371,132	E137V	probably damaging	Het
Fshr	A	C	17: 88,988,497	F261V	probably damaging	Het
Gabrb3	C	T	7: 57,812,178	R153*	probably null	Het
Gps2	C	A	11: 69,916,482	N321K	probably benign	Het
Hdgf	T	C	3: 87,906,686	M20T	possibly damaging	Het
Igdcc4	G	T	9: 65,124,024	A415S	probably damaging	Het
Kif26b	A	G	1: 178,914,976	E879G	probably damaging	Het
Krt13	T	C	11: 100,119,336	Y273C	probably damaging	Het
Mag	A	G	7: 30,909,134	V185A	possibly damaging	Het
Map3k21	C	T	8: 125,938,800	T576M	probably damaging	Het
Mtrr	A	G	13: 68,566,217	F468L	probably damaging	Het
Myb	C	T	10: 21,141,754		probably null	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nckap5l	A	T	15: 99,423,285		probably null	Het
Nop9	C	T	14: 55,749,352	R240W	probably benign	Het
Notch2	T	C	3: 98,113,114	L775P	probably damaging	Het
Olfr1221	C	T	2: 89,112,285	V76I	probably benign	Het
Olfr19	T	C	16: 16,673,715	N89D	probably benign	Het
Olfr25	A	G	9: 38,329,943	T116A	probably damaging	Het
Olfr545	T	A	7: 102,494,020	I252F	possibly damaging	Het
Olfr60	T	C	7: 140,345,230	Y253C	probably damaging	Het
Oxa1l	T	A	14: 54,363,477	W136R	probably damaging	Het
Palm3	T	A	8: 84,021,507	V7E	possibly damaging	Het
Pkhd1l1	C	G	15: 44,514,930	R1027G	possibly damaging	Het
Prickle2	A	T	6: 92,375,948	*902K	probably null	Het
Rassf7	C	T	7: 141,217,188	R105*	probably null	Het
Sept9	T	C	11: 117,326,511		probably null	Het
Soga1	A	C	2: 157,053,589	L332R	probably damaging	Het
Sorbs3	T	C	14: 70,207,527	N34S	probably benign	Het
Sos2	T	C	12: 69,635,638	T269A	probably benign	Het
Spata20	T	G	11: 94,482,553	K497N	probably benign	Het
Speg	A	G	1: 75,431,279	D3206G	probably damaging	Het
Tenm4	A	G	7: 96,888,814	T1865A	probably damaging	Het
Tmc5	A	T	7: 118,623,326	Y83F	probably benign	Het
Tmem175	T	A	5: 108,641,849	D103E	probably damaging	Het
Top2b	A	C	14: 16,412,946	M952L	probably benign	Het
Vmn2r6	T	C	3: 64,556,520	I298V	probably benign	Het
Vmn2r69	T	C	7: 85,407,212	I573V	probably benign	Het
Vmn2r93	A	G	17: 18,298,469	I63M	probably benign	Het
Zfp568	G	A	7: 30,023,256	R542H	probably benign	Het

Other mutations in Dars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01660:Dars	APN	1	128415344	splice site	probably benign
IGL02260:Dars	APN	1	128372161	missense	probably benign	0.19
IGL03264:Dars	APN	1	128413690	missense	probably damaging	1.00
R0308:Dars	UTSW	1	128364259	missense	probably damaging	1.00
R0609:Dars	UTSW	1	128405381	missense	probably benign	0.00
R1148:Dars	UTSW	1	128366909	splice site	probably benign
R1598:Dars	UTSW	1	128373972	missense	probably benign	0.00
R2092:Dars	UTSW	1	128374018	missense	probably damaging	1.00
R2140:Dars	UTSW	1	128372162	missense	probably benign	0.00
R2196:Dars	UTSW	1	128378858	missense	probably damaging	1.00
R4735:Dars	UTSW	1	128376234	nonsense	probably null
R5294:Dars	UTSW	1	128364302	missense	probably benign	0.02
R5521:Dars	UTSW	1	128373973	missense	probably benign	0.01
R6137:Dars	UTSW	1	128368439	missense	probably benign	0.44
R6784:Dars	UTSW	1	128391347	missense	probably damaging	1.00
R6899:Dars	UTSW	1	128413746	missense	possibly damaging	0.83
R7284:Dars	UTSW	1	128372267	missense	probably benign
R7437:Dars	UTSW	1	128372204	missense	possibly damaging	0.46
Z1176:Dars	UTSW	1	128372207	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGAGGAGACTTATTATGAGACATC -3'
(R):5'- ACCACTGCTTTAGATAAGGTGC -3'

Sequencing Primer
(F):5'- GCTCTCTCTGTAAGCAAC -3'
(R):5'- TGCTCTGATTATTGAGAGGTAACC -3'

Posted On

2019-10-17