Incidental Mutation 'R7562:Cntn2'
ID585169
Institutional Source Beutler Lab
Gene Symbol Cntn2
Ensembl Gene ENSMUSG00000053024
Gene Namecontactin 2
Synonymsaxonin, Tax, TAG-1, D130012K04Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_177129.5; MGI:104518

Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location132509427-132543256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132526317 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 317 (D317G)
Ref Sequence ENSEMBL: ENSMUSP00000083707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086521] [ENSMUST00000188943]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086521
AA Change: D317G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024
AA Change: D317G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188065
Predicted Effect probably benign
Transcript: ENSMUST00000188943
SMART Domains Protein: ENSMUSP00000139795
Gene: ENSMUSG00000053024

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
PDB:2OM5|A 36 103 9e-37 PDB
SCOP:d1cs6a1 36 103 2e-11 SMART
Blast:IGc2 54 103 1e-30 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 2181052; 2677610; 3521785
FUNCTION: This gene encodes a member of the contactin family of proteins, part of the immunoglobulin superfamily of cell adhesion molecules. The encoded glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein plays a role in the proliferation, migration, and axon guidance of neurons of the developing cerebellum. Mice lacking a functional copy of this gene exhibit epileptic seizures and elevated expression of A1 adenosine receptors. [provided by RefSeq, Sep 2016]
PHENOTYPE: Targeted mutation of this locus results in molecular abnormalities in the central nervous system. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Cntn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Cntn2 APN 1 132521884 splice site probably benign
IGL01137:Cntn2 APN 1 132521297 splice site probably benign
IGL01339:Cntn2 APN 1 132518905 splice site probably null
IGL01369:Cntn2 APN 1 132516105 missense probably benign
IGL01572:Cntn2 APN 1 132528171 missense probably damaging 1.00
IGL02389:Cntn2 APN 1 132525321 missense probably damaging 0.99
IGL02473:Cntn2 APN 1 132518331 missense probably benign
IGL02550:Cntn2 APN 1 132529063 missense probably null 0.03
IGL02608:Cntn2 APN 1 132525916 missense possibly damaging 0.87
IGL02755:Cntn2 APN 1 132529302 missense probably benign 0.43
IGL02850:Cntn2 APN 1 132518376 missense probably benign 0.00
IGL02887:Cntn2 APN 1 132516570 missense probably damaging 0.96
IGL03060:Cntn2 APN 1 132528940 missense probably benign 0.03
IGL03224:Cntn2 APN 1 132523042 missense probably damaging 1.00
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0009:Cntn2 UTSW 1 132516180 nonsense probably null
R0270:Cntn2 UTSW 1 132521724 missense probably damaging 1.00
R0739:Cntn2 UTSW 1 132529012 missense probably damaging 1.00
R0849:Cntn2 UTSW 1 132522386 missense probably benign 0.09
R0903:Cntn2 UTSW 1 132533684 small deletion probably benign
R1463:Cntn2 UTSW 1 132521137 critical splice donor site probably null
R1512:Cntn2 UTSW 1 132523692 missense probably damaging 0.99
R1535:Cntn2 UTSW 1 132525384 missense probably benign 0.26
R1686:Cntn2 UTSW 1 132526311 missense possibly damaging 0.78
R1696:Cntn2 UTSW 1 132521279 missense probably damaging 0.96
R1708:Cntn2 UTSW 1 132519198 missense probably damaging 0.96
R2251:Cntn2 UTSW 1 132525321 missense probably damaging 0.99
R2315:Cntn2 UTSW 1 132522997 missense probably benign 0.00
R2395:Cntn2 UTSW 1 132526372 missense probably benign
R3617:Cntn2 UTSW 1 132528623 missense probably benign 0.16
R3883:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R3884:Cntn2 UTSW 1 132528939 missense probably damaging 0.99
R4060:Cntn2 UTSW 1 132525896 missense probably damaging 0.99
R4289:Cntn2 UTSW 1 132527743 missense probably benign 0.01
R4710:Cntn2 UTSW 1 132528225 missense possibly damaging 0.84
R4921:Cntn2 UTSW 1 132516032 missense possibly damaging 0.49
R5121:Cntn2 UTSW 1 132517060 nonsense probably null
R5288:Cntn2 UTSW 1 132523677 missense probably benign 0.18
R5360:Cntn2 UTSW 1 132518857 missense probably damaging 0.97
R5787:Cntn2 UTSW 1 132523059 missense probably damaging 1.00
R5817:Cntn2 UTSW 1 132518748 missense probably benign 0.21
R5930:Cntn2 UTSW 1 132523432 missense probably damaging 1.00
R6053:Cntn2 UTSW 1 132518352 missense probably benign 0.18
R7189:Cntn2 UTSW 1 132517086 missense probably damaging 1.00
R7352:Cntn2 UTSW 1 132522399 missense probably benign 0.02
R7689:Cntn2 UTSW 1 132516144 missense probably benign 0.00
R7764:Cntn2 UTSW 1 132522363 missense probably benign 0.21
X0018:Cntn2 UTSW 1 132533684 small deletion probably benign
Z1176:Cntn2 UTSW 1 132527788 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGGCACTCTCTGGTTG -3'
(R):5'- ATGCTCAGCTCAGCTCATC -3'

Sequencing Primer
(F):5'- AAATACTTGTGTGCTTTCTGTATGCC -3'
(R):5'- AGCTCAGCTCATCCCCTCTG -3'
Posted On2019-10-17