Incidental Mutation 'R7562:Ablim2'
ID585181
Institutional Source Beutler Lab
Gene Symbol Ablim2
Ensembl Gene ENSMUSG00000029095
Gene Nameactin-binding LIM protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location35757880-35884973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35873219 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 544 (T544M)
Ref Sequence ENSEMBL: ENSMUSP00000050571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054598] [ENSMUST00000101280] [ENSMUST00000114203] [ENSMUST00000114204] [ENSMUST00000114205] [ENSMUST00000114206] [ENSMUST00000114210] [ENSMUST00000129347]
Predicted Effect probably benign
Transcript: ENSMUST00000054598
AA Change: T544M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050571
Gene: ENSMUSG00000029095
AA Change: T544M

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 577 612 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101280
SMART Domains Protein: ENSMUSP00000098838
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 297 315 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
VHP 572 607 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114203
AA Change: T278M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109841
Gene: ENSMUSG00000029095
AA Change: T278M

DomainStartEndE-ValueType
PDB:1WIG|A 1 28 5e-13 PDB
low complexity region 35 53 N/A INTRINSIC
low complexity region 132 141 N/A INTRINSIC
low complexity region 211 223 N/A INTRINSIC
VHP 311 346 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114204
SMART Domains Protein: ENSMUSP00000109842
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
VHP 571 606 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114205
SMART Domains Protein: ENSMUSP00000109843
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 538 573 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114206
SMART Domains Protein: ENSMUSP00000109844
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 375 384 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
VHP 582 617 2.34e-19 SMART
Predicted Effect silent
Transcript: ENSMUST00000114210
SMART Domains Protein: ENSMUSP00000109848
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129347
AA Change: T596M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123525
Gene: ENSMUSG00000029095
AA Change: T596M

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
Pfam:AbLIM_anchor 295 513 2.1e-78 PFAM
Pfam:AbLIM_anchor 497 628 2.6e-37 PFAM
VHP 629 664 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151636
SMART Domains Protein: ENSMUSP00000123616
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 22 148 5.6e-54 PFAM
low complexity region 171 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153529
SMART Domains Protein: ENSMUSP00000118019
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 43 73 1.7e-17 PFAM
VHP 74 109 2.34e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Ablim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ablim2 APN 5 35824015 unclassified probably benign
IGL00945:Ablim2 APN 5 35837020 missense probably damaging 1.00
IGL02439:Ablim2 APN 5 35857862 missense possibly damaging 0.89
IGL02664:Ablim2 APN 5 35849516 missense probably damaging 1.00
IGL02897:Ablim2 APN 5 35833126 missense probably damaging 1.00
IGL03034:Ablim2 APN 5 35828165 missense probably benign 0.00
IGL03096:Ablim2 APN 5 35883399 nonsense probably null
IGL03384:Ablim2 APN 5 35874872 missense probably damaging 1.00
R0128:Ablim2 UTSW 5 35809176 splice site probably benign
R0130:Ablim2 UTSW 5 35809176 splice site probably benign
R0212:Ablim2 UTSW 5 35848910 splice site probably null
R0344:Ablim2 UTSW 5 35836933 splice site probably benign
R0675:Ablim2 UTSW 5 35866780 splice site probably benign
R0788:Ablim2 UTSW 5 35857901 missense probably benign 0.01
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1493:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1809:Ablim2 UTSW 5 35843270 intron probably benign
R2070:Ablim2 UTSW 5 35798513 missense probably damaging 1.00
R2163:Ablim2 UTSW 5 35802353 splice site probably benign
R3962:Ablim2 UTSW 5 35812175 missense probably damaging 1.00
R4852:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4853:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4854:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4855:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4866:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4867:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4906:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4908:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4909:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4927:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R5210:Ablim2 UTSW 5 35837072 missense probably benign 0.44
R5225:Ablim2 UTSW 5 35866771 splice site probably null
R5439:Ablim2 UTSW 5 35857826 missense probably damaging 0.98
R5528:Ablim2 UTSW 5 35856166 nonsense probably null
R5629:Ablim2 UTSW 5 35857163 missense probably benign 0.01
R5653:Ablim2 UTSW 5 35883412 missense probably damaging 1.00
R5921:Ablim2 UTSW 5 35812211 missense probably damaging 1.00
R6059:Ablim2 UTSW 5 35857164 missense probably benign 0.37
R6241:Ablim2 UTSW 5 35874897 missense probably damaging 1.00
R7492:Ablim2 UTSW 5 35841329 missense probably benign 0.14
Z1176:Ablim2 UTSW 5 35848858 missense possibly damaging 0.84
Z1177:Ablim2 UTSW 5 35824043 missense probably damaging 0.98
Z1177:Ablim2 UTSW 5 35841293 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGTTCCCGGATATTCAC -3'
(R):5'- GTACTCCAAGAGATGCACAGC -3'

Sequencing Primer
(F):5'- CCAATGTTCAACGTTAGGTGAC -3'
(R):5'- CCCCTGCAGCATAGGATG -3'
Posted On2019-10-17