Incidental Mutation 'R7562:Alms1'
ID585184
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene NameALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location85587531-85702753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85620412 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 740 (L740P)
Ref Sequence ENSEMBL: ENSMUSP00000071904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
Predicted Effect probably damaging
Transcript: ENSMUST00000072018
AA Change: L740P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: L740P

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213058
AA Change: L1209P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7511:Alms1 UTSW 6 85609425 missense unknown
R7542:Alms1 UTSW 6 85629362 missense possibly damaging 0.62
R7575:Alms1 UTSW 6 85622159 missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85615320 missense probably benign 0.09
R7618:Alms1 UTSW 6 85678417 missense probably benign 0.07
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85615351 missense probably damaging 1.00
R7807:Alms1 UTSW 6 85622976 missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85615358 missense probably benign 0.42
R7849:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R7932:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R8048:Alms1 UTSW 6 85641334 missense probably benign 0.13
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Z1176:Alms1 UTSW 6 85678418 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TACTTCCTCTTCGCATGCAGAG -3'
(R):5'- AATGTTCTGGTCAGCTGGCC -3'

Sequencing Primer
(F):5'- ATGCAGAGAAGCCTGTTTCC -3'
(R):5'- GTCAGCTGGCCAAGGAAC -3'
Posted On2019-10-17