Incidental Mutation 'R7562:Mag'
ID585190
Institutional Source Beutler Lab
Gene Symbol Mag
Ensembl Gene ENSMUSG00000036634
Gene Namemyelin-associated glycoprotein
SynonymsGma, siglec-4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30899176-30914873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30909134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 185 (V185A)
Ref Sequence ENSEMBL: ENSMUSP00000139881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040548] [ENSMUST00000187137] [ENSMUST00000188569] [ENSMUST00000190638] [ENSMUST00000190950] [ENSMUST00000191081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040548
AA Change: V185A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041464
Gene: ENSMUSG00000036634
AA Change: V185A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187137
AA Change: V185A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139564
Gene: ENSMUSG00000036634
AA Change: V185A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188569
SMART Domains Protein: ENSMUSP00000140526
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
Blast:IG 152 195 1e-19 BLAST
IGc2 210 270 5.74e-13 SMART
IGc2 296 357 7.64e-9 SMART
transmembrane domain 469 491 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190638
SMART Domains Protein: ENSMUSP00000140578
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
Blast:IG 144 168 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190950
SMART Domains Protein: ENSMUSP00000139861
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
Blast:CLECT 1 64 3e-39 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000191081
AA Change: V185A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139881
Gene: ENSMUSG00000036634
AA Change: V185A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
IG 144 237 1.8e-2 SMART
IGc2 252 312 2.4e-15 SMART
IGc2 338 399 3e-11 SMART
transmembrane domain 511 533 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type I membrane protein and member of the immunoglobulin-like superfamily. It is expressed in myelinating glial cells, including oligodendrocytes of the central nervous system and Schwann cells of the peripheral nervous system. Mice lacking the encoded protein express abundant myelin, but suffer long-term axon degeneration, altered distribution of channels and adhesion molecules at nodes of Ranvier, and altered axon cytoskeletal structure. While not required for myelination, the encoded protein enhances axon-myelin stability, helps to structure nodes of Ranvier, and regulates the axon cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed CNS myelination, late myelin degeneration in peripheral nerves, hypomyelination of optic nerves, and subtle intention tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Mag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Mag APN 7 30900387 missense probably benign 0.00
IGL02036:Mag APN 7 30908452 missense probably damaging 0.97
IGL03263:Mag APN 7 30899528 unclassified probably null
regie UTSW 7 30900729 missense probably damaging 0.98
R0005:Mag UTSW 7 30908354 splice site probably benign
R0403:Mag UTSW 7 30906980 missense probably damaging 1.00
R1590:Mag UTSW 7 30901852 missense probably damaging 0.99
R1874:Mag UTSW 7 30909051 missense probably benign 0.13
R2170:Mag UTSW 7 30908987 nonsense probably null
R2192:Mag UTSW 7 30900641 nonsense probably null
R3176:Mag UTSW 7 30901648 critical splice donor site probably null
R3177:Mag UTSW 7 30901648 critical splice donor site probably null
R3276:Mag UTSW 7 30901648 critical splice donor site probably null
R3277:Mag UTSW 7 30901648 critical splice donor site probably null
R4540:Mag UTSW 7 30900729 missense probably damaging 0.98
R4635:Mag UTSW 7 30906923 missense probably damaging 1.00
R4704:Mag UTSW 7 30909173 missense probably damaging 1.00
R4891:Mag UTSW 7 30900368 missense probably benign 0.04
R4940:Mag UTSW 7 30909200 missense probably damaging 1.00
R4952:Mag UTSW 7 30909156 nonsense probably null
R6301:Mag UTSW 7 30900679 missense probably damaging 1.00
R6441:Mag UTSW 7 30907083 missense possibly damaging 0.65
R6951:Mag UTSW 7 30911433 missense possibly damaging 0.89
X0024:Mag UTSW 7 30907071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAACTCAACCAGCGTAGACC -3'
(R):5'- GACTGCTCCTAGAACCCTTC -3'

Sequencing Primer
(F):5'- AACGGGGTCCTGTTCCAGAG -3'
(R):5'- GACTGCTCCTAGAACCCTTCTTTTTC -3'
Posted On2019-10-17