Incidental Mutation 'R7562:5430419D17Rik'
ID585196
Institutional Source Beutler Lab
Gene Symbol 5430419D17Rik
Ensembl Gene ENSMUSG00000006204
Gene NameRIKEN cDNA 5430419D17 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location131174402-131306451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131302697 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2381 (D2381E)
Ref Sequence ENSEMBL: ENSMUSP00000150784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124096] [ENSMUST00000208921]
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208921
AA Change: D2381E
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in 5430419D17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:5430419D17Rik APN 7 131238094 unclassified probably null
IGL00848:5430419D17Rik APN 7 131246724 missense probably damaging 1.00
IGL00966:5430419D17Rik APN 7 131243107 nonsense probably null
IGL01286:5430419D17Rik APN 7 131246703 missense probably damaging 1.00
IGL01303:5430419D17Rik APN 7 131194331 missense possibly damaging 0.53
IGL01585:5430419D17Rik APN 7 131244758 missense probably damaging 0.97
IGL01665:5430419D17Rik APN 7 131246657 nonsense probably null
IGL01953:5430419D17Rik APN 7 131224980 missense probably benign 0.04
IGL02427:5430419D17Rik APN 7 131244788 missense probably damaging 0.99
IGL02508:5430419D17Rik APN 7 131222830 missense probably damaging 1.00
IGL02678:5430419D17Rik APN 7 131228917 missense probably damaging 1.00
IGL03092:5430419D17Rik APN 7 131201798 critical splice donor site probably null
IGL03122:5430419D17Rik APN 7 131196514 missense possibly damaging 0.68
IGL03343:5430419D17Rik APN 7 131246691 missense probably damaging 1.00
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0268:5430419D17Rik UTSW 7 131238176 missense probably damaging 1.00
R0383:5430419D17Rik UTSW 7 131239539 missense probably benign 0.05
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0974:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R1572:5430419D17Rik UTSW 7 131244831 nonsense probably null
R1911:5430419D17Rik UTSW 7 131238089 missense probably damaging 1.00
R2032:5430419D17Rik UTSW 7 131243052 missense probably damaging 1.00
R2097:5430419D17Rik UTSW 7 131181964 nonsense probably null
R2221:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2223:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2254:5430419D17Rik UTSW 7 131222905 missense probably damaging 1.00
R2913:5430419D17Rik UTSW 7 131182024 missense possibly damaging 0.90
R2991:5430419D17Rik UTSW 7 131246700 missense probably damaging 1.00
R3439:5430419D17Rik UTSW 7 131188779 critical splice donor site probably null
R4418:5430419D17Rik UTSW 7 131247465 missense possibly damaging 0.86
R4916:5430419D17Rik UTSW 7 131174477 synonymous probably null
R5488:5430419D17Rik UTSW 7 131246595 missense probably damaging 1.00
R5594:5430419D17Rik UTSW 7 131239523 missense probably benign 0.12
R5897:5430419D17Rik UTSW 7 131196551 splice site probably null
R5898:5430419D17Rik UTSW 7 131241967 splice site probably null
R5940:5430419D17Rik UTSW 7 131238263 missense probably damaging 1.00
R6170:5430419D17Rik UTSW 7 131174487 splice site probably null
R6187:5430419D17Rik UTSW 7 131270599 intron probably benign
R6321:5430419D17Rik UTSW 7 131257006 critical splice donor site probably null
R6409:5430419D17Rik UTSW 7 131262071 intron probably benign
R6432:5430419D17Rik UTSW 7 131244872 critical splice donor site probably null
R6481:5430419D17Rik UTSW 7 131256801 missense probably benign 0.05
R6750:5430419D17Rik UTSW 7 131288245 intron probably benign
R6783:5430419D17Rik UTSW 7 131226764 missense probably damaging 0.99
R6836:5430419D17Rik UTSW 7 131196504 missense possibly damaging 0.84
R6925:5430419D17Rik UTSW 7 131222707 missense possibly damaging 0.92
R6995:5430419D17Rik UTSW 7 131222671 missense probably damaging 1.00
R7199:5430419D17Rik UTSW 7 131235912 nonsense probably null
R7205:5430419D17Rik UTSW 7 131277623 critical splice donor site probably null
R7340:5430419D17Rik UTSW 7 131277615 missense unknown
R7354:5430419D17Rik UTSW 7 131256729 missense possibly damaging 0.84
R7354:5430419D17Rik UTSW 7 131272033 missense unknown
R7434:5430419D17Rik UTSW 7 131279483 missense unknown
R7485:5430419D17Rik UTSW 7 131228833 missense probably damaging 0.99
R7513:5430419D17Rik UTSW 7 131272071 missense unknown
Z1088:5430419D17Rik UTSW 7 131246633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTCTGCAGTTGAAATTGTG -3'
(R):5'- TTCCCCACTGTGATCAGAGG -3'

Sequencing Primer
(F):5'- AGGACGATGTGAGCTATGATGTATC -3'
(R):5'- GTCTGGTTGGAACACCCTACAC -3'
Posted On2019-10-17