Incidental Mutation 'R7562:Rassf7'
ID585198
Institutional Source Beutler Lab
Gene Symbol Rassf7
Ensembl Gene ENSMUSG00000038618
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141215860-141218658 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 141217188 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 105 (R105*)
Ref Sequence ENSEMBL: ENSMUSP00000038444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026573] [ENSMUST00000046890] [ENSMUST00000127613] [ENSMUST00000133763] [ENSMUST00000141804] [ENSMUST00000148975] [ENSMUST00000153081] [ENSMUST00000170841] [ENSMUST00000209500] [ENSMUST00000210993]
Predicted Effect probably benign
Transcript: ENSMUST00000026573
SMART Domains Protein: ENSMUSP00000026573
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 114 170 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:LTD 375 482 1.3e-13 PFAM
low complexity region 567 578 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000046890
AA Change: R105*
SMART Domains Protein: ENSMUSP00000038444
Gene: ENSMUSG00000038618
AA Change: R105*

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 244 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127613
Predicted Effect probably null
Transcript: ENSMUST00000133763
AA Change: R105*
SMART Domains Protein: ENSMUSP00000118313
Gene: ENSMUSG00000038618
AA Change: R105*

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141804
AA Change: R105*
SMART Domains Protein: ENSMUSP00000115948
Gene: ENSMUSG00000038618
AA Change: R105*

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148975
SMART Domains Protein: ENSMUSP00000118078
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
Blast:RA 6 35 5e-13 BLAST
PDB:2CS4|A 7 35 2e-11 PDB
low complexity region 36 47 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153081
AA Change: R105*
SMART Domains Protein: ENSMUSP00000123128
Gene: ENSMUSG00000038618
AA Change: R105*

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170841
SMART Domains Protein: ENSMUSP00000130905
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 124 180 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
SCOP:d1ifra_ 385 487 1e-22 SMART
low complexity region 577 588 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209500
AA Change: R105*
Predicted Effect probably null
Transcript: ENSMUST00000210993
AA Change: R105*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Rassf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02098:Rassf7 APN 7 141218290 missense possibly damaging 0.95
R0883:Rassf7 UTSW 7 141216990 splice site probably benign
R1275:Rassf7 UTSW 7 141217147 missense probably damaging 1.00
R1616:Rassf7 UTSW 7 141216732 missense probably damaging 1.00
R5546:Rassf7 UTSW 7 141217060 unclassified probably null
R5597:Rassf7 UTSW 7 141217111 missense probably damaging 1.00
R5663:Rassf7 UTSW 7 141217090 missense probably damaging 1.00
R6250:Rassf7 UTSW 7 141217243 missense probably damaging 0.98
R6806:Rassf7 UTSW 7 141216809 missense probably damaging 1.00
R6817:Rassf7 UTSW 7 141217447 missense probably damaging 1.00
R6962:Rassf7 UTSW 7 141217590 missense possibly damaging 0.86
R7054:Rassf7 UTSW 7 141217643 missense probably benign 0.01
R7682:Rassf7 UTSW 7 141217934 missense probably damaging 1.00
X0026:Rassf7 UTSW 7 141218132 nonsense probably null
Z1088:Rassf7 UTSW 7 141217145 missense probably damaging 1.00
Z1177:Rassf7 UTSW 7 141218285 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ATAGGCTGAACCCGTCTCTC -3'
(R):5'- ATCCTGAGTTCTAGGTCCTGCAG -3'

Sequencing Primer
(F):5'- GCCAGACAGGTCGATTTGTC -3'
(R):5'- AGGTCTGCAAAGCCGTCTG -3'
Posted On2019-10-17