Incidental Mutation 'R7562:Spata20'
ID 585206
Institutional Source Beutler Lab
Gene Symbol Spata20
Ensembl Gene ENSMUSG00000020867
Gene Name spermatogenesis associated 20
Synonyms Tisp78
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock # R7562 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 94478904-94486179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 94482553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 497 (K497N)
Ref Sequence ENSEMBL: ENSMUSP00000042572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041705]
AlphaFold Q80YT5
Predicted Effect probably benign
Transcript: ENSMUST00000041705
AA Change: K497N

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042572
Gene: ENSMUSG00000020867
AA Change: K497N

DomainStartEndE-ValueType
Pfam:Thioredox_DsbH 66 228 2.9e-75 PFAM
Pfam:Thioredoxin_7 86 176 1.5e-13 PFAM
SCOP:d1fp3a_ 464 686 8e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Spata20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Spata20 APN 11 94479117 missense probably damaging 1.00
IGL01123:Spata20 APN 11 94483395 missense probably benign
IGL02008:Spata20 APN 11 94483463 missense probably damaging 1.00
PIT4458001:Spata20 UTSW 11 94484608 missense probably damaging 1.00
R0136:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R0243:Spata20 UTSW 11 94481646 missense probably benign
R0557:Spata20 UTSW 11 94485222 missense probably benign 0.00
R0657:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R1712:Spata20 UTSW 11 94480514 missense probably benign
R2166:Spata20 UTSW 11 94479104 missense probably benign 0.25
R4298:Spata20 UTSW 11 94483088 missense probably damaging 0.99
R4740:Spata20 UTSW 11 94484578 missense possibly damaging 0.94
R4791:Spata20 UTSW 11 94484586 missense probably damaging 0.99
R4980:Spata20 UTSW 11 94484609 missense probably damaging 1.00
R5894:Spata20 UTSW 11 94483618 missense probably damaging 0.98
R6373:Spata20 UTSW 11 94483400 missense probably benign
R7400:Spata20 UTSW 11 94483400 missense probably benign
R7439:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7441:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7974:Spata20 UTSW 11 94484140 missense possibly damaging 0.66
R8036:Spata20 UTSW 11 94479137 missense probably benign 0.17
R8060:Spata20 UTSW 11 94482239 missense probably benign
R8335:Spata20 UTSW 11 94482543 missense probably benign 0.05
R8447:Spata20 UTSW 11 94482254 missense probably damaging 1.00
R8676:Spata20 UTSW 11 94481781 missense probably damaging 1.00
R9492:Spata20 UTSW 11 94483618 missense probably damaging 0.98
Z1176:Spata20 UTSW 11 94480535 missense probably benign 0.45
Z1177:Spata20 UTSW 11 94483139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCAGGTTCACTTAGACTC -3'
(R):5'- GAGGACTTTTGCAGACACAGAG -3'

Sequencing Primer
(F):5'- GCAGGTTCACTTAGACTCTTTAGATC -3'
(R):5'- CTTTTGCAGACACAGAGAAGGATCC -3'
Posted On 2019-10-17