Incidental Mutation 'R7562:Bdp1'
ID585212
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100025541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2291 (D2291G)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably benign
Transcript: ENSMUST00000038104
AA Change: D2291G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: D2291G

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably benign
Transcript: ENSMUST00000109379
AA Change: D2291G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: D2291G

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7583:Bdp1 UTSW 13 100049812 missense probably damaging 1.00
R7788:Bdp1 UTSW 13 100055251 missense possibly damaging 0.64
R7842:Bdp1 UTSW 13 100099129 missense probably damaging 1.00
R7850:Bdp1 UTSW 13 100092324 missense probably damaging 1.00
R7904:Bdp1 UTSW 13 100041436 missense probably benign 0.37
R7925:Bdp1 UTSW 13 100099129 missense probably damaging 1.00
R7933:Bdp1 UTSW 13 100092324 missense probably damaging 1.00
R7987:Bdp1 UTSW 13 100041436 missense probably benign 0.37
R7999:Bdp1 UTSW 13 100058896 missense not run
RF003:Bdp1 UTSW 13 100060449 missense probably benign 0.31
RF003:Bdp1 UTSW 13 100060450 missense probably benign 0.31
Z1177:Bdp1 UTSW 13 100061396 missense not run
Predicted Primers PCR Primer
(F):5'- CAGAGAGACAGTCACTACAGAGTC -3'
(R):5'- TAAGCTGGGTTTGTTATAGAACACC -3'

Sequencing Primer
(F):5'- GTCTCTAATAATACCTGGTCAGAGGG -3'
(R):5'- ATAGAACACCATGGGTTTTTCCTTC -3'
Posted On2019-10-17