Incidental Mutation 'R7562:Fbxo34'
List |< first << previous [record 29 of 71] next >> last >|
ID585216
Institutional Source Beutler Lab
Gene Symbol Fbxo34
Ensembl Gene ENSMUSG00000037536
Gene NameF-box protein 34
Synonyms5830426G16Rik, 2900057B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location47450421-47531962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47529678 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 216 (M216K)
Ref Sequence ENSEMBL: ENSMUSP00000044675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043112] [ENSMUST00000095941] [ENSMUST00000163324] [ENSMUST00000165714] [ENSMUST00000168833] [ENSMUST00000226395] [ENSMUST00000226432] [ENSMUST00000226954] [ENSMUST00000228019] [ENSMUST00000228668] [ENSMUST00000228740]
Predicted Effect probably benign
Transcript: ENSMUST00000043112
AA Change: M216K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044675
Gene: ENSMUSG00000037536
AA Change: M216K

DomainStartEndE-ValueType
low complexity region 8 45 N/A INTRINSIC
FBOX 613 653 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095941
AA Change: M165K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093634
Gene: ENSMUSG00000037536
AA Change: M165K

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163324
AA Change: M165K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131708
Gene: ENSMUSG00000037536
AA Change: M165K

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165714
AA Change: M165K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130036
Gene: ENSMUSG00000037536
AA Change: M165K

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168833
AA Change: M165K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132271
Gene: ENSMUSG00000037536
AA Change: M165K

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226395
Predicted Effect probably benign
Transcript: ENSMUST00000226432
Predicted Effect probably benign
Transcript: ENSMUST00000226954
Predicted Effect probably benign
Transcript: ENSMUST00000227601
Predicted Effect probably benign
Transcript: ENSMUST00000228019
Predicted Effect probably benign
Transcript: ENSMUST00000228668
Predicted Effect probably benign
Transcript: ENSMUST00000228740
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO34, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Fbxo34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Fbxo34 APN 14 47529474 missense probably damaging 0.97
IGL01337:Fbxo34 APN 14 47530217 missense probably benign 0.05
IGL01418:Fbxo34 APN 14 47530784 missense possibly damaging 0.46
IGL02069:Fbxo34 APN 14 47529613 missense probably damaging 1.00
IGL02829:Fbxo34 APN 14 47529689 missense probably benign 0.00
R0601:Fbxo34 UTSW 14 47530257 missense probably benign
R0714:Fbxo34 UTSW 14 47530029 missense probably damaging 1.00
R1186:Fbxo34 UTSW 14 47530586 missense probably damaging 0.99
R1714:Fbxo34 UTSW 14 47529201 missense probably damaging 1.00
R1842:Fbxo34 UTSW 14 47531007 missense probably damaging 0.98
R2127:Fbxo34 UTSW 14 47530106 missense probably damaging 0.98
R4199:Fbxo34 UTSW 14 47530997 missense probably damaging 1.00
R4649:Fbxo34 UTSW 14 47529628 missense probably damaging 1.00
R4801:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4802:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4906:Fbxo34 UTSW 14 47529454 missense probably benign 0.26
R5475:Fbxo34 UTSW 14 47529345 missense probably benign 0.01
R5888:Fbxo34 UTSW 14 47529719 missense probably damaging 0.98
R6573:Fbxo34 UTSW 14 47529667 missense possibly damaging 0.61
R7236:Fbxo34 UTSW 14 47530384 missense probably benign 0.00
R7257:Fbxo34 UTSW 14 47500872 critical splice donor site probably null
R7381:Fbxo34 UTSW 14 47530535 missense probably benign 0.02
R7515:Fbxo34 UTSW 14 47530341 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CTGGGCTATTGTCAAACCTGG -3'
(R):5'- GCCAGAAATCTTCACAATGGC -3'

Sequencing Primer
(F):5'- GGCTATTGTCAAACCTGGGAACAC -3'
(R):5'- CTTCACAATGGCAGGCGAATTTG -3'
Posted On2019-10-17