Incidental Mutation 'R7562:Oxa1l'
ID585217
Institutional Source Beutler Lab
Gene Symbol Oxa1l
Ensembl Gene ENSMUSG00000000959
Gene Nameoxidase assembly 1-like
Synonyms1810020M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54360834-54369673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54363477 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 136 (W136R)
Ref Sequence ENSEMBL: ENSMUSP00000000985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000985]
Predicted Effect probably damaging
Transcript: ENSMUST00000000985
AA Change: W136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000985
Gene: ENSMUSG00000000959
AA Change: W136R

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:60KD_IMP 135 330 4.1e-28 PFAM
low complexity region 406 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228719
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved protein that is localized to the inner mitochondrial membrane. The encoded protein is essential for the translocation of the N-terminal tail of subunit 2 of cytochrome c oxidase, and is involved in the assembly of the cytochrome c oxidase and ATPase complexes of the mitochondrial respiratory chain. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Oxa1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Oxa1l APN 14 54363345 nonsense probably null
R0196:Oxa1l UTSW 14 54363487 missense probably damaging 1.00
R0541:Oxa1l UTSW 14 54368189 missense possibly damaging 0.80
R1773:Oxa1l UTSW 14 54363452 missense probably benign 0.01
R2197:Oxa1l UTSW 14 54361467 missense probably benign 0.29
R5652:Oxa1l UTSW 14 54366832 nonsense probably null
R5850:Oxa1l UTSW 14 54367664 missense possibly damaging 0.87
R5898:Oxa1l UTSW 14 54363301 missense possibly damaging 0.50
R6088:Oxa1l UTSW 14 54367694 critical splice donor site probably null
R6162:Oxa1l UTSW 14 54368332 missense probably damaging 1.00
R6869:Oxa1l UTSW 14 54366738 missense probably damaging 1.00
R7244:Oxa1l UTSW 14 54360855 start codon destroyed probably benign 0.33
R7247:Oxa1l UTSW 14 54360855 start codon destroyed probably benign 0.33
R7317:Oxa1l UTSW 14 54360855 start codon destroyed probably benign 0.33
R8018:Oxa1l UTSW 14 54363300 missense not run
Predicted Primers PCR Primer
(F):5'- TACCTCTATCCCTGCTGCAG -3'
(R):5'- GCTCAAATGAAGGTTTTGCAAACG -3'

Sequencing Primer
(F):5'- TGCAGTACCAGAGGTAGCTTC -3'
(R):5'- ACCCGCCTATGGATCAGTATGTAG -3'
Posted On2019-10-17