Incidental Mutation 'R7562:Sorbs3'
ID585219
Institutional Source Beutler Lab
Gene Symbol Sorbs3
Ensembl Gene ENSMUSG00000022091
Gene Namesorbin and SH3 domain containing 3
SynonymsSH3P3, Sh3d4, vinexin beta, vinexin alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7562 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70180468-70211989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70207527 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 34 (N34S)
Ref Sequence ENSEMBL: ENSMUSP00000022682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022682] [ENSMUST00000227259] [ENSMUST00000227653] [ENSMUST00000227929]
Predicted Effect probably benign
Transcript: ENSMUST00000022682
AA Change: N34S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022682
Gene: ENSMUSG00000022091
AA Change: N34S

DomainStartEndE-ValueType
Sorb 165 214 6.87e-30 SMART
SH3 447 502 9.24e-21 SMART
SH3 521 578 4.18e-19 SMART
low complexity region 597 613 N/A INTRINSIC
SH3 677 733 8.31e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227259
Predicted Effect probably benign
Transcript: ENSMUST00000227653
Predicted Effect probably benign
Transcript: ENSMUST00000227929
AA Change: N34S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an SH3 domain-containing adaptor protein. The presence of SH3 domains play a role in this protein's ability to bind other cytoplasmic molecules and contribute to cystoskeletal organization, cell adhesion and migration, signaling, and gene expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutants are generally normal, viable, and fertile, except showing delayed wound healing in response to full-thickness skin injury in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Sept9 T C 11: 117,326,511 probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Sorbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sorbs3 APN 14 70191155 missense probably damaging 1.00
IGL01144:Sorbs3 APN 14 70191568 missense probably benign 0.04
IGL01155:Sorbs3 APN 14 70199341 missense probably damaging 1.00
IGL01465:Sorbs3 APN 14 70195509 splice site probably benign
IGL02184:Sorbs3 APN 14 70184006 critical splice donor site probably null
R0544:Sorbs3 UTSW 14 70193926 missense probably benign 0.01
R0882:Sorbs3 UTSW 14 70207572 missense probably damaging 1.00
R1445:Sorbs3 UTSW 14 70193646 missense probably benign 0.12
R1493:Sorbs3 UTSW 14 70192627 missense possibly damaging 0.71
R1505:Sorbs3 UTSW 14 70190802 nonsense probably null
R1671:Sorbs3 UTSW 14 70191466 missense possibly damaging 0.92
R2184:Sorbs3 UTSW 14 70191431 critical splice donor site probably null
R3804:Sorbs3 UTSW 14 70199351 splice site probably benign
R4527:Sorbs3 UTSW 14 70207617 missense probably damaging 1.00
R4755:Sorbs3 UTSW 14 70184099 missense probably benign 0.00
R4926:Sorbs3 UTSW 14 70186945 missense probably damaging 1.00
R5257:Sorbs3 UTSW 14 70185034 missense probably benign 0.00
R5304:Sorbs3 UTSW 14 70184896 nonsense probably null
R5328:Sorbs3 UTSW 14 70181174 missense probably damaging 1.00
R5684:Sorbs3 UTSW 14 70181222 missense probably damaging 1.00
R5988:Sorbs3 UTSW 14 70203303 missense probably benign 0.03
R6106:Sorbs3 UTSW 14 70192604 splice site probably null
R7207:Sorbs3 UTSW 14 70201485 missense probably damaging 1.00
R7831:Sorbs3 UTSW 14 70203032 missense possibly damaging 0.93
R7893:Sorbs3 UTSW 14 70193916 missense probably benign 0.35
R7914:Sorbs3 UTSW 14 70203032 missense possibly damaging 0.93
R7976:Sorbs3 UTSW 14 70193916 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CACAGTACACGGTGTTTGTGGG -3'
(R):5'- AACAGGAAGTTGGGACCTTCG -3'

Sequencing Primer
(F):5'- GCGGAGGTAGGAAAGCTG -3'
(R):5'- TTGGGACCTTCGGCAGCTC -3'
Posted On2019-10-17