Mutagenetix > Incidental Mutation

Incidental Mutation 'R7562:Adamts12'

585220

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R7562 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11270611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 651 (R651G)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061318
AA Change: R651G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: R651G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	C	A	1: 93,159,967	V55F	probably damaging	Het
4930539E08Rik	T	C	17: 28,909,804	D45G	probably benign	Het
5430419D17Rik	T	A	7: 131,302,697	D2381E	unknown	Het
Ablim2	C	T	5: 35,873,219	T544M	probably benign	Het
Adck1	G	A	12: 88,368,433	D30N	possibly damaging	Het
Alcam	T	A	16: 52,268,823	I505F	probably benign	Het
Alms1	T	C	6: 85,620,412	L740P	probably damaging	Het
Ankib1	C	T	5: 3,747,021	D264N	probably null	Het
Arid2	T	G	15: 96,401,968	H1787Q	probably damaging	Het
Asf1a	C	T	10: 53,606,187	R102*	probably null	Het
Atp2b1	C	A	10: 99,022,805		probably null	Het
Bdp1	T	C	13: 100,025,541	D2291G	probably benign	Het
Brinp3	C	G	1: 146,902,010	L732V	possibly damaging	Het
Catsperg2	A	G	7: 29,697,719	F1120L	probably benign	Het
Ccdc80	C	T	16: 45,122,903	A792V	probably damaging	Het
Cenpe	C	T	3: 135,248,634	R1751W	probably damaging	Het
Cenpm	T	C	15: 82,241,361	I66V	probably benign	Het
Clcn4	A	G	7: 7,295,082	W103R	possibly damaging	Het
Cntn2	T	C	1: 132,526,317	D317G	possibly damaging	Het
Cwf19l1	G	A	19: 44,129,241	T154M	probably damaging	Het
Cyp2a4	T	A	7: 26,312,896	M368K	possibly damaging	Het
Dars	A	G	1: 128,367,026	S413P	possibly damaging	Het
Dscc1	A	G	15: 55,084,185	Y200H	probably benign	Het
Dsn1	A	T	2: 157,000,872	D183E	probably damaging	Het
Etfdh	T	C	3: 79,623,579	Y45C	probably damaging	Het
Fam71f1	T	C	6: 29,323,834	V186A	probably damaging	Het
Fancc	A	T	13: 63,403,053		probably null	Het
Fbxo34	T	A	14: 47,529,678	M216K	probably benign	Het
Fer1l6	T	G	15: 58,560,482	S293A	probably benign	Het
Foxn1	T	A	11: 78,371,132	E137V	probably damaging	Het
Fshr	A	C	17: 88,988,497	F261V	probably damaging	Het
Gabrb3	C	T	7: 57,812,178	R153*	probably null	Het
Gps2	C	A	11: 69,916,482	N321K	probably benign	Het
Hdgf	T	C	3: 87,906,686	M20T	possibly damaging	Het
Igdcc4	G	T	9: 65,124,024	A415S	probably damaging	Het
Kif26b	A	G	1: 178,914,976	E879G	probably damaging	Het
Krt13	T	C	11: 100,119,336	Y273C	probably damaging	Het
Mag	A	G	7: 30,909,134	V185A	possibly damaging	Het
Map3k21	C	T	8: 125,938,800	T576M	probably damaging	Het
Mtrr	A	G	13: 68,566,217	F468L	probably damaging	Het
Myb	C	T	10: 21,141,754		probably null	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Nckap5l	A	T	15: 99,423,285		probably null	Het
Nop9	C	T	14: 55,749,352	R240W	probably benign	Het
Notch2	T	C	3: 98,113,114	L775P	probably damaging	Het
Olfr1221	C	T	2: 89,112,285	V76I	probably benign	Het
Olfr19	T	C	16: 16,673,715	N89D	probably benign	Het
Olfr25	A	G	9: 38,329,943	T116A	probably damaging	Het
Olfr545	T	A	7: 102,494,020	I252F	possibly damaging	Het
Olfr60	T	C	7: 140,345,230	Y253C	probably damaging	Het
Oxa1l	T	A	14: 54,363,477	W136R	probably damaging	Het
Palm3	T	A	8: 84,021,507	V7E	possibly damaging	Het
Pkhd1l1	C	G	15: 44,514,930	R1027G	possibly damaging	Het
Prickle2	A	T	6: 92,375,948	*902K	probably null	Het
Rassf7	C	T	7: 141,217,188	R105*	probably null	Het
Sept9	T	C	11: 117,326,511		probably null	Het
Soga1	A	C	2: 157,053,589	L332R	probably damaging	Het
Sorbs3	T	C	14: 70,207,527	N34S	probably benign	Het
Sos2	T	C	12: 69,635,638	T269A	probably benign	Het
Spata20	T	G	11: 94,482,553	K497N	probably benign	Het
Speg	A	G	1: 75,431,279	D3206G	probably damaging	Het
Tenm4	A	G	7: 96,888,814	T1865A	probably damaging	Het
Tmc5	A	T	7: 118,623,326	Y83F	probably benign	Het
Tmem175	T	A	5: 108,641,849	D103E	probably damaging	Het
Top2b	A	C	14: 16,412,946	M952L	probably benign	Het
Vmn2r6	T	C	3: 64,556,520	I298V	probably benign	Het
Vmn2r69	T	C	7: 85,407,212	I573V	probably benign	Het
Vmn2r93	A	G	17: 18,298,469	I63M	probably benign	Het
Zfp568	G	A	7: 30,023,256	R542H	probably benign	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- TCTAGTGTGTCAGAAAGTCAAAGGG -3'
(R):5'- TGTTTATCACAGCAACAGAAAGCAG -3'

Sequencing Primer
(F):5'- TCAAAGGGGTTTGTAAATGGTACCC -3'
(R):5'- CCCCACAACAGATTCAAGTAAATAC -3'

Posted On

2019-10-17